Incidental Mutation 'R2896:Zfp456'
ID260799
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Namezinc finger protein 456
SynonymsRslcan-13
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2896 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67362113-67375810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67367297 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 97 (R97G)
Ref Sequence ENSEMBL: ENSMUSP00000059686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266] [ENSMUST00000225787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057070
AA Change: R97G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: R97G

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165145
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172266
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225787
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R4971:Zfp456 UTSW 13 67366876 missense probably benign 0.31
R5357:Zfp456 UTSW 13 67372209 missense possibly damaging 0.71
R5754:Zfp456 UTSW 13 67366240 missense probably benign 0.40
R5795:Zfp456 UTSW 13 67366920 missense probably benign
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R6904:Zfp456 UTSW 13 67366265 missense probably benign 0.44
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
R7690:Zfp456 UTSW 13 67366794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCTGAGAGATGAAGATGA -3'
(R):5'- ACAGGCATTGAAATATACTGTGGATTT -3'

Sequencing Primer
(F):5'- GAGGGGAAAGTCTTTTCACACAATC -3'
(R):5'- GCTTAACTTTTGTTCATATC -3'
Posted On2015-01-23