Incidental Mutation 'R2896:Olfr748'
ID 260801
Institutional Source Beutler Lab
Gene Symbol Olfr748
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor 748
Synonyms GA_x6K02T2PMLR-6454789-6455712, MOR106-9P
MMRRC Submission 040484-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R2896 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50707373-50713797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50710516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 62 (F62S)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: F62S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Olfr748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr748 APN 14 50710993 missense possibly damaging 0.95
IGL02965:Olfr748 APN 14 50711196 missense probably damaging 1.00
R0576:Olfr748 UTSW 14 50711204 missense probably damaging 0.98
R1184:Olfr748 UTSW 14 50710614 missense probably benign 0.01
R2129:Olfr748 UTSW 14 50710636 missense probably damaging 0.99
R2895:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R4017:Olfr748 UTSW 14 50710876 missense probably benign 0.03
R5053:Olfr748 UTSW 14 50710511 nonsense probably null
R5057:Olfr748 UTSW 14 50711212 missense probably damaging 1.00
R5113:Olfr748 UTSW 14 50710914 missense probably benign 0.00
R5294:Olfr748 UTSW 14 50710443 missense possibly damaging 0.95
R5294:Olfr748 UTSW 14 50710779 missense probably benign 0.01
R5499:Olfr748 UTSW 14 50710867 missense probably damaging 1.00
R5582:Olfr748 UTSW 14 50710968 missense probably damaging 1.00
R5727:Olfr748 UTSW 14 50710360 missense possibly damaging 0.74
R6797:Olfr748 UTSW 14 50711106 missense probably damaging 1.00
R7685:Olfr748 UTSW 14 50710758 missense possibly damaging 0.95
R7717:Olfr748 UTSW 14 50710762 missense probably damaging 1.00
R7778:Olfr748 UTSW 14 50710471 missense possibly damaging 0.60
R8276:Olfr748 UTSW 14 50710830 missense probably benign 0.28
R8839:Olfr748 UTSW 14 50710500 missense possibly damaging 0.73
R9322:Olfr748 UTSW 14 50711050 missense probably damaging 1.00
R9358:Olfr748 UTSW 14 50710345 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACGTGTCAGAGGGATCC -3'
(R):5'- TGCCTAGTCATGATGGAAGGATAG -3'

Sequencing Primer
(F):5'- AGAGGGATCCACGGTGACATATTTTG -3'
(R):5'- TGGCTAGGTACCGATCATAAGCC -3'
Posted On 2015-01-23