Incidental Mutation 'R2896:Esp6'
ID260807
Institutional Source Beutler Lab
Gene Symbol Esp6
Ensembl Gene ENSMUSG00000092043
Gene Nameexocrine gland secreted peptide 6
SynonymsGm5494, Esp5
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40561507-40565622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40562943 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000094930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097324] [ENSMUST00000167713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097324
AA Change: M7K

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094930
Gene: ENSMUSG00000092043
AA Change: M7K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ESP 24 88 8.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167713
SMART Domains Protein: ENSMUSP00000128205
Gene: ENSMUSG00000090897

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ESP 24 84 2e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Esp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0883:Esp6 UTSW 17 40565396 missense probably benign 0.01
R1136:Esp6 UTSW 17 40565393 missense probably benign 0.20
R1483:Esp6 UTSW 17 40562925 start codon destroyed probably null 0.92
R4303:Esp6 UTSW 17 40565144 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACCAATTACAAGCATGGTTAGCAC -3'
(R):5'- TGTCACTAGTGGGTACTACAGC -3'

Sequencing Primer
(F):5'- GCATGGTTAGCACAATAAAACTACAG -3'
(R):5'- CACTAGTGGGTACTACAGCTTCTAG -3'
Posted On2015-01-23