Incidental Mutation 'R2896:Stard6'
ID260808
Institutional Source Beutler Lab
Gene Symbol Stard6
Ensembl Gene ENSMUSG00000079608
Gene NameStAR-related lipid transfer (START) domain containing 6
Synonyms1700011K09Rik, 4833424I06Rik, 4933429L05Rik
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70472454-70501066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70476388 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 33 (V33I)
Ref Sequence ENSEMBL: ENSMUSP00000134511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067556] [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667] [ENSMUST00000212539] [ENSMUST00000212683]
Predicted Effect probably benign
Transcript: ENSMUST00000067556
SMART Domains Protein: ENSMUSP00000065118
Gene: ENSMUSG00000044906

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:LAS2 161 235 2.8e-26 PFAM
Pfam:LAS2 325 387 9.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114959
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164223
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168249
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
AA Change: V33I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174118
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212539
Predicted Effect probably benign
Transcript: ENSMUST00000212683
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Stard6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Stard6 APN 18 70483488 missense probably benign 0.00
IGL02403:Stard6 APN 18 70496112 critical splice acceptor site probably null
IGL02934:Stard6 APN 18 70496104 splice site probably benign
IGL03144:Stard6 APN 18 70476111 missense possibly damaging 0.53
R0344:Stard6 UTSW 18 70496115 missense probably damaging 1.00
R2850:Stard6 UTSW 18 70483451 missense probably benign 0.20
R3236:Stard6 UTSW 18 70500486 missense probably damaging 0.99
R4532:Stard6 UTSW 18 70483534 missense probably damaging 1.00
R4959:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R4973:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R5080:Stard6 UTSW 18 70496222 missense probably damaging 1.00
R6380:Stard6 UTSW 18 70476388 missense probably benign 0.02
R7331:Stard6 UTSW 18 70483482 missense probably damaging 1.00
R7396:Stard6 UTSW 18 70500435 missense possibly damaging 0.95
R7399:Stard6 UTSW 18 70498647 splice site probably null
R8002:Stard6 UTSW 18 70500526 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GACCTATCTGGCTGGAAACTC -3'
(R):5'- AGCACGTGATCTCACACATC -3'

Sequencing Primer
(F):5'- GGCTGGAAACTCATTAAATCTTCAG -3'
(R):5'- AGCACGTGATCTCACACATCATTTC -3'
Posted On2015-01-23