Incidental Mutation 'R2897:Zfp37'
ID260833
Institutional Source Beutler Lab
Gene Symbol Zfp37
Ensembl Gene ENSMUSG00000028389
Gene Namezinc finger protein 37
SynonymsZfp-37, Tzn
MMRRC Submission 040485-MU
Accession Numbers

Genbank: NM_009554.3; Ensembl: ENSMUST00000068822

Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62189540-62231047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62191777 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 350 (G350D)
Ref Sequence ENSEMBL: ENSMUSP00000152400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068822] [ENSMUST00000129511] [ENSMUST00000220873] [ENSMUST00000221329] [ENSMUST00000222050] [ENSMUST00000222748]
Predicted Effect probably damaging
Transcript: ENSMUST00000068822
AA Change: G391D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070463
Gene: ENSMUSG00000028389
AA Change: G391D

DomainStartEndE-ValueType
KRAB 13 62 5.89e-12 SMART
low complexity region 113 122 N/A INTRINSIC
ZnF_C2H2 255 277 2.75e-3 SMART
ZnF_C2H2 283 305 3.95e-4 SMART
ZnF_C2H2 311 333 2.2e-2 SMART
ZnF_C2H2 339 361 8.02e-5 SMART
ZnF_C2H2 367 389 1.13e-4 SMART
ZnF_C2H2 395 417 9.88e-5 SMART
ZnF_C2H2 423 445 2.61e-4 SMART
ZnF_C2H2 451 473 6.08e-5 SMART
ZnF_C2H2 479 501 5.99e-4 SMART
ZnF_C2H2 507 529 5.99e-4 SMART
ZnF_C2H2 535 557 1.03e-2 SMART
ZnF_C2H2 563 585 9.88e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129511
AA Change: G37D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148664
Predicted Effect probably damaging
Transcript: ENSMUST00000220873
AA Change: G350D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221329
AA Change: G388D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222050
AA Change: G387D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222748
AA Change: G350D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to a large family of zinc finger proteins. A similar protein in mouse is thought to play a role in regulating the structures of the nucleolus and centromere in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nlrc4 T A 17: 74,448,045 M59L probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Vps41 T C 13: 18,810,428 probably benign Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Other mutations in Zfp37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02742:Zfp37 APN 4 62192311 missense possibly damaging 0.69
B6584:Zfp37 UTSW 4 62191378 missense probably damaging 1.00
R0383:Zfp37 UTSW 4 62191885 start codon destroyed probably null 0.61
R0457:Zfp37 UTSW 4 62191665 nonsense probably null
R1258:Zfp37 UTSW 4 62191817 missense probably damaging 1.00
R2072:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2073:Zfp37 UTSW 4 62191708 missense probably damaging 1.00
R2261:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2262:Zfp37 UTSW 4 62191636 missense probably damaging 1.00
R2507:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R2898:Zfp37 UTSW 4 62191777 missense probably damaging 1.00
R3826:Zfp37 UTSW 4 62192563 missense probably benign 0.00
R3879:Zfp37 UTSW 4 62191335 nonsense probably null
R4034:Zfp37 UTSW 4 62191696 missense probably damaging 1.00
R4491:Zfp37 UTSW 4 62192128 missense probably benign 0.07
R4823:Zfp37 UTSW 4 62191503 missense probably benign 0.18
R5186:Zfp37 UTSW 4 62191256 missense probably damaging 1.00
R5650:Zfp37 UTSW 4 62191765 missense probably damaging 1.00
R5886:Zfp37 UTSW 4 62191234 missense probably damaging 1.00
R5925:Zfp37 UTSW 4 62191213 missense possibly damaging 0.47
R7050:Zfp37 UTSW 4 62191671 missense possibly damaging 0.72
R7553:Zfp37 UTSW 4 62191999 missense probably damaging 1.00
R7583:Zfp37 UTSW 4 62192016 start gained probably benign
R7646:Zfp37 UTSW 4 62191295 missense probably damaging 0.99
R8061:Zfp37 UTSW 4 62191428 nonsense probably null
X0026:Zfp37 UTSW 4 62205089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCAAAGGCTTTCCCACA -3'
(R):5'- CACACTGCCGTACTCCATCT -3'

Sequencing Primer
(F):5'- TTCCCACACTCATCACATTTATAAGG -3'
(R):5'- GGATAGCTTTCAGCCAGAAGTCC -3'
Posted On2015-01-23