Mutagenetix > Incidental Mutation

Incidental Mutation 'R2897:Lrriq1'

260859

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

040485-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R2897 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103227250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 65 (N65S)

Ref Sequence

ENSEMBL: ENSMUSP00000119783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020043
AA Change: N65S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: N65S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123364
AA Change: N65S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: N65S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: N65S

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N65S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Meta Mutation Damage Score

0.1044

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

99% (72/73)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,323,521	V1015A	probably benign	Het
4930480E11Rik	C	T	X: 78,370,262	Q198*	probably null	Het
Acap3	G	C	4: 155,904,931		probably null	Het
Adamts14	T	C	10: 61,204,910	D879G	probably damaging	Het
Akap1	A	T	11: 88,844,779	C352*	probably null	Het
Ankk1	T	A	9: 49,421,822	T121S	probably benign	Het
Ankrd6	T	C	4: 32,860,438	S2G	probably damaging	Het
Anks1	G	T	17: 27,985,363		probably null	Het
Apob	G	A	12: 8,010,356	G2946D	probably damaging	Het
Atm	A	C	9: 53,507,805	C782W	probably damaging	Het
Atp1a4	A	T	1: 172,246,690	I332N	probably damaging	Het
Bnc2	T	C	4: 84,292,915	I406V	probably damaging	Het
Cdh20	A	T	1: 104,947,474	D327V	probably damaging	Het
Cep192	T	A	18: 67,855,270		probably null	Het
Chd5	T	C	4: 152,372,115	F970L	probably damaging	Het
Coq9	T	C	8: 94,853,124	Y236H	probably damaging	Het
Csn1s2a	A	G	5: 87,781,821	H93R	unknown	Het
Cxcr2	T	C	1: 74,158,971	V208A	probably benign	Het
Cyp1b1	G	A	17: 79,713,731	T194M	probably benign	Het
Dbt	T	A	3: 116,523,412	V79E	probably damaging	Het
Dcx	A	G	X: 143,923,432		probably benign	Het
Dnm3	G	A	1: 162,286,074		probably benign	Het
Erbin	C	T	13: 103,886,197	E45K	probably damaging	Het
Fastkd1	A	G	2: 69,702,616	L469P	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm10271	A	G	10: 116,972,590	L7S	probably damaging	Het
Gm5087	T	C	14: 13,158,805		noncoding transcript	Het
Hid1	A	G	11: 115,350,530	S645P	probably benign	Het
Hmcn1	C	T	1: 150,802,873	C499Y	probably damaging	Het
Ifna1	C	A	4: 88,850,213	Q43K	probably benign	Het
Ikbkb	G	T	8: 22,669,677	Q432K	possibly damaging	Het
Inpp4a	A	T	1: 37,366,594	H148L	probably benign	Het
Itpr2	C	T	6: 146,173,341	R2338Q	probably benign	Het
Itpr2	A	T	6: 146,323,169	I1441N	probably damaging	Het
Krt78	T	C	15: 101,947,106	R757G	probably benign	Het
Lmx1a	T	A	1: 167,830,540		probably benign	Het
Lpxn	T	A	19: 12,819,358	S81T	probably benign	Het
Mis18bp1	T	C	12: 65,133,586	D981G	probably benign	Het
Mpp4	T	C	1: 59,144,694	I296V	probably benign	Het
Mtrf1l	T	C	10: 5,817,565	R184G	probably benign	Het
Muc19	T	C	15: 91,924,665		noncoding transcript	Het
Myo6	T	A	9: 80,269,611		probably null	Het
Myom1	A	G	17: 71,101,220		probably benign	Het
Ndrg4	A	G	8: 95,678,386		probably null	Het
Neu2	A	G	1: 87,595,060	S72G	probably benign	Het
Nlrc4	T	A	17: 74,448,045	M59L	probably benign	Het
Nuak2	A	T	1: 132,325,053	H115L	probably damaging	Het
Olfr243	A	T	7: 103,717,542	Y316F	probably benign	Het
Olfr433	T	C	1: 174,042,133	F61S	probably damaging	Het
Oog1	T	A	12: 87,608,408	I272K	probably damaging	Het
Pcdhb1	A	G	18: 37,266,463	Y489C	probably damaging	Het
Pde5a	T	C	3: 122,779,002	I344T	probably benign	Het
Pip5kl1	C	A	2: 32,583,347	A332D	probably benign	Het
Pja1	T	C	X: 99,467,148	E385G	probably benign	Het
Psma6	A	T	12: 55,408,044	I53L	probably benign	Het
Ric8b	T	G	10: 84,947,897	D206E	probably benign	Het
Sardh	T	C	2: 27,189,547	D911G	probably benign	Het
Serpinb8	A	G	1: 107,607,046	T32A	unknown	Het
Shroom2	G	T	X: 152,660,039	T710K	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc38a7	A	G	8: 95,845,796		probably benign	Het
Stk36	T	A	1: 74,632,825	S895T	probably null	Het
Sycp3	G	A	10: 88,472,682	E205K	possibly damaging	Het
Tbc1d16	A	T	11: 119,157,828	I333N	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Tmeff1	T	A	4: 48,658,831	Y101*	probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttn	T	A	2: 76,719,156	T23399S	probably damaging	Het
Vipas39	A	G	12: 87,242,523	V389A	possibly damaging	Het
Vps41	T	C	13: 18,810,428		probably benign	Het
Zfp329	A	T	7: 12,810,486	H370Q	probably damaging	Het
Zfp37	C	T	4: 62,191,777	G350D	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACAGTACTATTCTGGAAAAGGCAG -3'
(R):5'- GACCTTTTATATGGGCACTTTTACC -3'

Sequencing Primer
(F):5'- TCTGGAAAAGGCAGAGTTAACCTTC -3'
(R):5'- GGGCACTTTTACCTATTTACACAG -3'

Posted On

2015-01-23