Incidental Mutation 'R2883:Retreg2'
ID260890
Institutional Source Beutler Lab
Gene Symbol Retreg2
Ensembl Gene ENSMUSG00000049339
Gene Namereticulophagy regulator family member 2
SynonymsMGC47289, Fam134a
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75142778-75147913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75146712 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 428 (P428L)
Ref Sequence ENSEMBL: ENSMUSP00000139410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041213] [ENSMUST00000097694] [ENSMUST00000168720] [ENSMUST00000187901] [ENSMUST00000188873] [ENSMUST00000189403] [ENSMUST00000189650] [ENSMUST00000189809] [ENSMUST00000190240]
Predicted Effect probably benign
Transcript: ENSMUST00000041213
SMART Domains Protein: ENSMUSP00000044799
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 72 174 7.5e-10 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097694
AA Change: P428L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000095300
Gene: ENSMUSG00000049339
AA Change: P428L

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 453 491 N/A INTRINSIC
low complexity region 506 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168720
SMART Domains Protein: ENSMUSP00000132688
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 49 174 5.2e-13 PFAM
Pfam:Cyclin_N 55 175 4.4e-6 PFAM
low complexity region 231 252 N/A INTRINSIC
low complexity region 256 268 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186037
AA Change: P376L
Predicted Effect probably benign
Transcript: ENSMUST00000187901
SMART Domains Protein: ENSMUSP00000140636
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 12 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188873
SMART Domains Protein: ENSMUSP00000139508
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 84 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188977
Predicted Effect probably benign
Transcript: ENSMUST00000189345
Predicted Effect probably benign
Transcript: ENSMUST00000189403
SMART Domains Protein: ENSMUSP00000141062
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Pfam:Cyclin 44 170 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189650
SMART Domains Protein: ENSMUSP00000139473
Gene: ENSMUSG00000049339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 75 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189809
SMART Domains Protein: ENSMUSP00000140262
Gene: ENSMUSG00000033159

DomainStartEndE-ValueType
Blast:CYCLIN 81 114 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190240
AA Change: P428L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139410
Gene: ENSMUSG00000049339
AA Change: P428L

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:Reticulon 65 231 1.4e-8 PFAM
low complexity region 269 283 N/A INTRINSIC
low complexity region 435 454 N/A INTRINSIC
low complexity region 469 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Retreg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Retreg2 APN 1 75145105 critical splice donor site probably null
IGL01625:Retreg2 APN 1 75144715 unclassified probably benign
R0143:Retreg2 UTSW 1 75146430 missense possibly damaging 0.82
R1248:Retreg2 UTSW 1 75145111 unclassified probably benign
R1446:Retreg2 UTSW 1 75143459 missense possibly damaging 0.69
R1463:Retreg2 UTSW 1 75146520 missense probably damaging 0.98
R1734:Retreg2 UTSW 1 75142986 splice site probably null
R1851:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R1852:Retreg2 UTSW 1 75146675 missense probably benign 0.00
R3027:Retreg2 UTSW 1 75146444 missense probably damaging 0.99
R4665:Retreg2 UTSW 1 75144666 missense probably damaging 1.00
R5497:Retreg2 UTSW 1 75144989 missense probably damaging 1.00
R5544:Retreg2 UTSW 1 75144689 makesense probably null
R6143:Retreg2 UTSW 1 75146886 missense probably damaging 1.00
R6881:Retreg2 UTSW 1 75146439 missense probably damaging 1.00
R7576:Retreg2 UTSW 1 75144688 missense probably damaging 0.99
R7822:Retreg2 UTSW 1 75146541 missense possibly damaging 0.63
Z1176:Retreg2 UTSW 1 75145743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGACCTGCTAAGTGCG -3'
(R):5'- GCATTCAGTTGCTCCAGCTC -3'

Sequencing Primer
(F):5'- TGCTAAGTGCGCCTCCAG -3'
(R):5'- GCAACTCAAAGTCCTCAGTTGTG -3'
Posted On2015-01-23