Incidental Mutation 'R2883:Myoc'
ID260892
Institutional Source Beutler Lab
Gene Symbol Myoc
Ensembl Gene ENSMUSG00000026697
Gene Namemyocilin
SynonymsTIGR, GLC1A
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162639155-162649693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162639616 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 118 (E118G)
Ref Sequence ENSEMBL: ENSMUSP00000028020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028020]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028020
AA Change: E118G

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028020
Gene: ENSMUSG00000026697
AA Change: E118G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 96 169 N/A INTRINSIC
OLF 232 489 2.54e-161 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile and display no ocular abnormalities at the light and ultrastructural microscopic levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Myoc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Myoc APN 1 162639774 missense probably benign 0.10
IGL02314:Myoc APN 1 162639348 missense probably damaging 1.00
IGL02707:Myoc APN 1 162639460 missense probably benign 0.28
R0033:Myoc UTSW 1 162648441 missense probably damaging 1.00
R0193:Myoc UTSW 1 162649035 missense probably damaging 1.00
R0573:Myoc UTSW 1 162648674 missense probably damaging 1.00
R1433:Myoc UTSW 1 162648996 missense probably damaging 1.00
R1525:Myoc UTSW 1 162648651 missense probably damaging 1.00
R1637:Myoc UTSW 1 162639367 missense probably damaging 1.00
R2268:Myoc UTSW 1 162649056 missense probably damaging 1.00
R4437:Myoc UTSW 1 162649112 missense possibly damaging 0.67
R4845:Myoc UTSW 1 162647465 missense possibly damaging 0.95
R4904:Myoc UTSW 1 162639425 missense probably benign 0.25
R5092:Myoc UTSW 1 162639634 missense probably damaging 1.00
R5629:Myoc UTSW 1 162648587 missense probably damaging 1.00
R5847:Myoc UTSW 1 162639367 missense probably damaging 1.00
R5920:Myoc UTSW 1 162639559 missense probably benign
R6326:Myoc UTSW 1 162649011 missense probably damaging 1.00
R6589:Myoc UTSW 1 162648619 nonsense probably null
R6932:Myoc UTSW 1 162639346 missense probably damaging 1.00
R7282:Myoc UTSW 1 162648844 missense probably benign 0.04
R7697:Myoc UTSW 1 162647480 missense probably damaging 1.00
R7698:Myoc UTSW 1 162639445 missense probably damaging 1.00
R7724:Myoc UTSW 1 162639827 critical splice donor site probably null
R7791:Myoc UTSW 1 162649121 missense probably damaging 1.00
R8272:Myoc UTSW 1 162639426 missense probably benign 0.00
R8290:Myoc UTSW 1 162649032 missense possibly damaging 0.51
R8872:Myoc UTSW 1 162647444 missense probably benign 0.00
R8920:Myoc UTSW 1 162647558 missense probably benign 0.01
Z1176:Myoc UTSW 1 162639636 nonsense probably null
Z1176:Myoc UTSW 1 162649154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAATCTAGCTGCCCAAGGG -3'
(R):5'- TACTGGGTGGAAGGACACTG -3'

Sequencing Primer
(F):5'- TGTCAGCCATCCAAGACCTTCAG -3'
(R):5'- AAGGACACTGGCCCCTC -3'
Posted On2015-01-23