Incidental Mutation 'R2883:Usp20'
ID 260898
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2883 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31018800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 798 (V798M)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000102849
AA Change: V798M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: V798M

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127776
Predicted Effect probably benign
Transcript: ENSMUST00000170476
AA Change: V798M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: V798M

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCCTGTGCTCAAGAGTATG -3'
(R):5'- CTTTCCATGAGTCTCAGGCAC -3'

Sequencing Primer
(F):5'- CCCCTGTGCTCAAGAGTATGATAGAG -3'
(R):5'- AGAGCCTAGCGATCCTCAGCTAG -3'
Posted On 2015-01-23