Incidental Mutation 'R2883:Fat4'
ID 260904
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission 040471-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2883 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 38886940-39011985 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38980804 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2868 (N2868K)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: N2868K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: N2868K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G A 8: 121,539,905 (GRCm38) P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 (GRCm38) Q790R probably benign Het
Asic2 T A 11: 80,894,013 (GRCm38) I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 (GRCm38) S1191P probably benign Het
Bod1l A G 5: 41,832,259 (GRCm38) S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 (GRCm38) F167I probably damaging Het
Cimip3 C A 17: 47,436,725 (GRCm38) V32F probably damaging Het
Col13a1 A G 10: 61,978,356 (GRCm38) L94P probably benign Het
Cped1 A T 6: 22,143,979 (GRCm38) T575S probably damaging Het
Cpt1b T C 15: 89,417,869 (GRCm38) Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 (GRCm38) N84I probably damaging Het
Dse A T 10: 34,152,507 (GRCm38) D862E probably benign Het
Etl4 A T 2: 20,806,174 (GRCm38) T1023S possibly damaging Het
Fgd5 G A 6: 91,987,109 (GRCm38) probably null Het
Fsip2 C T 2: 82,991,524 (GRCm38) T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 (GRCm38) T203A probably benign Het
Gli2 T C 1: 118,868,144 (GRCm38) I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 (GRCm38) V122A possibly damaging Het
Kif1b G A 4: 149,237,648 (GRCm38) T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 (GRCm38) D767G probably damaging Het
Mageb3 A G 2: 121,954,366 (GRCm38) V285A probably benign Het
Myoc A G 1: 162,639,616 (GRCm38) E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 (GRCm38) F410V probably damaging Het
Nipal1 A T 5: 72,667,730 (GRCm38) K255N probably damaging Het
Npr3 T C 15: 11,883,324 (GRCm38) K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 (GRCm38) G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 (GRCm38) L188P probably damaging Het
Or51ac3 T C 7: 103,565,264 (GRCm38) N5S probably benign Het
Or5v1 C T 17: 37,499,380 (GRCm38) S243F probably damaging Het
Or9q1 T A 19: 13,827,875 (GRCm38) I174F probably damaging Het
Otogl G A 10: 107,768,981 (GRCm38) T2188M probably damaging Het
Pck1 G A 2: 173,158,575 (GRCm38) V600I probably benign Het
Ranbp17 A G 11: 33,504,708 (GRCm38) C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 (GRCm38) R53H probably benign Het
Rbm12 G A 2: 156,097,075 (GRCm38) H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 (GRCm38) P428L probably benign Het
Rev3l G T 10: 39,825,156 (GRCm38) S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 (GRCm38) probably null Het
Rora T C 9: 69,375,435 (GRCm38) S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 (GRCm38) V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 (GRCm38) K335E probably damaging Het
Spata22 C A 11: 73,344,678 (GRCm38) H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 (GRCm38) probably benign Het
Stab2 A T 10: 86,967,686 (GRCm38) I333N possibly damaging Het
Supt5 A G 7: 28,329,320 (GRCm38) Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 (GRCm38) T825A probably benign Het
Usp20 G A 2: 31,018,800 (GRCm38) V798M probably benign Het
Wdr26 A T 1: 181,211,120 (GRCm38) D102E probably damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38,982,249 (GRCm38) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,889,039 (GRCm38) missense probably damaging 1.00
IGL00698:Fat4 APN 3 38,981,145 (GRCm38) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,890,673 (GRCm38) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,890,579 (GRCm38) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38,957,269 (GRCm38) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,007,201 (GRCm38) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38,980,658 (GRCm38) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,889,991 (GRCm38) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,887,498 (GRCm38) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,891,181 (GRCm38) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,888,070 (GRCm38) missense probably damaging 1.00
IGL01514:Fat4 APN 3 38,949,534 (GRCm38) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,009,257 (GRCm38) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,887,758 (GRCm38) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,888,947 (GRCm38) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,010,375 (GRCm38) nonsense probably null
IGL01626:Fat4 APN 3 38,951,032 (GRCm38) missense probably damaging 1.00
IGL01746:Fat4 APN 3 38,991,731 (GRCm38) nonsense probably null
IGL01800:Fat4 APN 3 38,981,729 (GRCm38) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,888,773 (GRCm38) missense probably damaging 1.00
IGL01863:Fat4 APN 3 38,970,619 (GRCm38) splice site probably benign
IGL01917:Fat4 APN 3 38,889,730 (GRCm38) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38,979,774 (GRCm38) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,010,271 (GRCm38) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,889,199 (GRCm38) missense probably damaging 0.97
IGL02119:Fat4 APN 3 38,982,939 (GRCm38) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,888,404 (GRCm38) missense probably damaging 1.00
IGL02164:Fat4 APN 3 38,996,205 (GRCm38) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,890,546 (GRCm38) missense probably damaging 1.00
IGL02207:Fat4 APN 3 38,951,263 (GRCm38) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,891,853 (GRCm38) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,001,139 (GRCm38) missense probably benign 0.09
IGL02271:Fat4 APN 3 38,979,919 (GRCm38) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,009,988 (GRCm38) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,887,630 (GRCm38) missense probably damaging 1.00
IGL02455:Fat4 APN 3 38,951,131 (GRCm38) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38,983,046 (GRCm38) missense probably benign
IGL02478:Fat4 APN 3 38,888,215 (GRCm38) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,010,430 (GRCm38) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,887,245 (GRCm38) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,002,764 (GRCm38) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,002,836 (GRCm38) missense probably benign 0.08
IGL02674:Fat4 APN 3 38,983,337 (GRCm38) missense probably benign 0.35
IGL02692:Fat4 APN 3 38,951,086 (GRCm38) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,890,595 (GRCm38) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,889,295 (GRCm38) missense probably damaging 1.00
IGL02834:Fat4 APN 3 38,956,744 (GRCm38) missense probably damaging 1.00
IGL02891:Fat4 APN 3 38,951,273 (GRCm38) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,890,843 (GRCm38) missense probably damaging 1.00
IGL02993:Fat4 APN 3 38,957,155 (GRCm38) missense probably damaging 1.00
IGL02996:Fat4 APN 3 38,958,525 (GRCm38) missense probably damaging 1.00
IGL03029:Fat4 APN 3 38,982,591 (GRCm38) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38,981,552 (GRCm38) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38,956,859 (GRCm38) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38,991,685 (GRCm38) missense probably damaging 1.00
IGL03169:Fat4 APN 3 38,957,398 (GRCm38) missense probably benign 0.02
IGL03190:Fat4 APN 3 38,981,241 (GRCm38) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,009,703 (GRCm38) missense probably benign
IGL03371:Fat4 APN 3 38,983,187 (GRCm38) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,889,134 (GRCm38) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38,957,227 (GRCm38) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,892,019 (GRCm38) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,009,364 (GRCm38) missense probably damaging 1.00
IGL03405:Fat4 APN 3 38,958,450 (GRCm38) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,891,176 (GRCm38) missense probably damaging 1.00
Asahi UTSW 3 38,981,819 (GRCm38) missense probably damaging 1.00
Expulsion UTSW 3 38,889,649 (GRCm38) missense probably benign 0.00
heineken UTSW 3 38,980,380 (GRCm38) missense probably damaging 1.00
schlitz UTSW 3 38,980,659 (GRCm38) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38,982,357 (GRCm38) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,889,004 (GRCm38) missense probably benign 0.04
R0015:Fat4 UTSW 3 38,982,503 (GRCm38) missense probably damaging 1.00
R0015:Fat4 UTSW 3 38,982,503 (GRCm38) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,888,931 (GRCm38) missense probably benign 0.35
R0100:Fat4 UTSW 3 38,980,248 (GRCm38) missense probably damaging 1.00
R0100:Fat4 UTSW 3 38,980,248 (GRCm38) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,891,596 (GRCm38) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,890,816 (GRCm38) missense probably benign
R0357:Fat4 UTSW 3 38,891,227 (GRCm38) missense probably damaging 1.00
R0409:Fat4 UTSW 3 38,977,413 (GRCm38) missense probably damaging 1.00
R0498:Fat4 UTSW 3 38,980,637 (GRCm38) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,002,924 (GRCm38) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,888,314 (GRCm38) missense probably benign 0.00
R0532:Fat4 UTSW 3 38,981,721 (GRCm38) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,942,870 (GRCm38) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,000,172 (GRCm38) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,889,694 (GRCm38) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,001,178 (GRCm38) missense probably benign
R0729:Fat4 UTSW 3 39,000,295 (GRCm38) splice site probably benign
R0748:Fat4 UTSW 3 38,887,828 (GRCm38) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38,957,474 (GRCm38) missense probably damaging 1.00
R0812:Fat4 UTSW 3 38,957,474 (GRCm38) missense probably damaging 1.00
R0830:Fat4 UTSW 3 38,999,109 (GRCm38) missense probably benign 0.26
R0841:Fat4 UTSW 3 38,995,998 (GRCm38) missense probably damaging 0.99
R0884:Fat4 UTSW 3 38,982,858 (GRCm38) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,891,392 (GRCm38) missense probably damaging 1.00
R1066:Fat4 UTSW 3 38,957,227 (GRCm38) missense probably damaging 1.00
R1078:Fat4 UTSW 3 38,983,086 (GRCm38) missense probably benign 0.10
R1084:Fat4 UTSW 3 38,979,825 (GRCm38) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38,982,942 (GRCm38) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,890,371 (GRCm38) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,890,813 (GRCm38) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,888,323 (GRCm38) missense probably damaging 1.00
R1487:Fat4 UTSW 3 38,995,917 (GRCm38) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38,983,076 (GRCm38) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,890,089 (GRCm38) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,888,986 (GRCm38) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,888,860 (GRCm38) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,007,177 (GRCm38) missense probably damaging 0.99
R1655:Fat4 UTSW 3 38,957,318 (GRCm38) missense probably damaging 0.97
R1662:Fat4 UTSW 3 38,980,779 (GRCm38) missense probably damaging 1.00
R1710:Fat4 UTSW 3 38,951,155 (GRCm38) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,891,310 (GRCm38) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,887,489 (GRCm38) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,010,268 (GRCm38) missense probably damaging 1.00
R1828:Fat4 UTSW 3 38,983,458 (GRCm38) missense probably damaging 1.00
R1835:Fat4 UTSW 3 38,983,571 (GRCm38) missense probably benign 0.00
R1846:Fat4 UTSW 3 38,982,383 (GRCm38) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,010,484 (GRCm38) missense probably benign 0.09
R1871:Fat4 UTSW 3 38,981,072 (GRCm38) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38,991,664 (GRCm38) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,996,090 (GRCm38) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,887,115 (GRCm38) missense probably benign
R2056:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,891,170 (GRCm38) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,010,655 (GRCm38) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,889,673 (GRCm38) missense probably damaging 1.00
R2114:Fat4 UTSW 3 38,981,484 (GRCm38) missense probably benign 0.01
R2135:Fat4 UTSW 3 38,980,733 (GRCm38) missense probably damaging 0.98
R2152:Fat4 UTSW 3 38,983,395 (GRCm38) missense probably damaging 1.00
R2153:Fat4 UTSW 3 38,983,395 (GRCm38) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,887,539 (GRCm38) missense probably damaging 1.00
R2196:Fat4 UTSW 3 38,981,417 (GRCm38) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,891,527 (GRCm38) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,010,215 (GRCm38) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,892,049 (GRCm38) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,888,989 (GRCm38) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,890,422 (GRCm38) missense probably benign 0.25
R2274:Fat4 UTSW 3 38,995,899 (GRCm38) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38,980,011 (GRCm38) missense probably damaging 1.00
R2343:Fat4 UTSW 3 38,957,105 (GRCm38) missense probably damaging 0.97
R2365:Fat4 UTSW 3 38,980,419 (GRCm38) missense probably benign
R2412:Fat4 UTSW 3 38,957,072 (GRCm38) missense probably benign 0.05
R2942:Fat4 UTSW 3 38,982,336 (GRCm38) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,007,153 (GRCm38) missense probably benign
R3103:Fat4 UTSW 3 38,891,940 (GRCm38) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,890,791 (GRCm38) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38,981,274 (GRCm38) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38,982,438 (GRCm38) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,007,261 (GRCm38) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,007,261 (GRCm38) missense probably benign 0.10
R3957:Fat4 UTSW 3 38,982,346 (GRCm38) missense probably benign
R4065:Fat4 UTSW 3 39,009,197 (GRCm38) missense probably benign 0.13
R4078:Fat4 UTSW 3 38,980,020 (GRCm38) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,887,875 (GRCm38) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,942,809 (GRCm38) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,891,627 (GRCm38) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,889,171 (GRCm38) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,891,763 (GRCm38) missense probably damaging 1.00
R4407:Fat4 UTSW 3 38,958,540 (GRCm38) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,891,294 (GRCm38) missense probably benign 0.01
R4547:Fat4 UTSW 3 38,951,283 (GRCm38) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,887,342 (GRCm38) missense probably damaging 1.00
R4826:Fat4 UTSW 3 38,982,957 (GRCm38) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,888,317 (GRCm38) missense probably benign
R4871:Fat4 UTSW 3 38,891,605 (GRCm38) missense probably damaging 1.00
R4897:Fat4 UTSW 3 38,980,632 (GRCm38) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,010,465 (GRCm38) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,007,203 (GRCm38) missense probably benign 0.00
R4941:Fat4 UTSW 3 38,957,452 (GRCm38) missense probably damaging 1.00
R4943:Fat4 UTSW 3 38,980,173 (GRCm38) missense probably benign 0.19
R4959:Fat4 UTSW 3 38,983,046 (GRCm38) missense probably benign 0.00
R4973:Fat4 UTSW 3 38,983,046 (GRCm38) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,888,289 (GRCm38) missense probably benign 0.34
R5163:Fat4 UTSW 3 38,980,797 (GRCm38) missense probably damaging 1.00
R5213:Fat4 UTSW 3 38,980,191 (GRCm38) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38,956,868 (GRCm38) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,010,378 (GRCm38) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,891,627 (GRCm38) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,888,005 (GRCm38) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,888,864 (GRCm38) missense probably damaging 1.00
R5384:Fat4 UTSW 3 38,995,946 (GRCm38) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,887,245 (GRCm38) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,891,346 (GRCm38) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,010,370 (GRCm38) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,887,215 (GRCm38) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,010,274 (GRCm38) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,888,934 (GRCm38) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,002,968 (GRCm38) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,889,625 (GRCm38) missense probably damaging 1.00
R5735:Fat4 UTSW 3 38,949,576 (GRCm38) missense probably damaging 1.00
R5739:Fat4 UTSW 3 38,983,134 (GRCm38) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,889,468 (GRCm38) missense probably damaging 1.00
R5780:Fat4 UTSW 3 38,980,955 (GRCm38) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,891,787 (GRCm38) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,007,305 (GRCm38) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,887,336 (GRCm38) missense probably benign
R5933:Fat4 UTSW 3 38,951,375 (GRCm38) critical splice donor site probably null
R5938:Fat4 UTSW 3 38,951,239 (GRCm38) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,889,649 (GRCm38) missense probably benign 0.00
R5945:Fat4 UTSW 3 38,983,206 (GRCm38) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,010,547 (GRCm38) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,002,802 (GRCm38) missense probably damaging 1.00
R6158:Fat4 UTSW 3 38,983,262 (GRCm38) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,891,721 (GRCm38) missense probably damaging 1.00
R6253:Fat4 UTSW 3 38,951,356 (GRCm38) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,007,246 (GRCm38) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,007,080 (GRCm38) splice site probably null
R6387:Fat4 UTSW 3 38,983,785 (GRCm38) missense probably damaging 1.00
R6390:Fat4 UTSW 3 38,980,380 (GRCm38) missense probably damaging 1.00
R6456:Fat4 UTSW 3 38,983,979 (GRCm38) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,890,887 (GRCm38) missense probably damaging 1.00
R6500:Fat4 UTSW 3 38,981,269 (GRCm38) nonsense probably null
R6503:Fat4 UTSW 3 38,982,257 (GRCm38) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,002,871 (GRCm38) missense probably benign
R6566:Fat4 UTSW 3 38,957,126 (GRCm38) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38,979,690 (GRCm38) missense probably benign
R6590:Fat4 UTSW 3 38,983,539 (GRCm38) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,942,928 (GRCm38) missense probably benign 0.01
R6662:Fat4 UTSW 3 38,956,821 (GRCm38) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38,983,539 (GRCm38) missense probably damaging 1.00
R6807:Fat4 UTSW 3 38,982,440 (GRCm38) missense probably benign 0.18
R6823:Fat4 UTSW 3 38,983,939 (GRCm38) missense probably benign 0.05
R6824:Fat4 UTSW 3 38,957,525 (GRCm38) missense probably benign 0.00
R6830:Fat4 UTSW 3 38,981,817 (GRCm38) missense probably benign 0.00
R6925:Fat4 UTSW 3 38,996,204 (GRCm38) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,009,446 (GRCm38) missense probably damaging 1.00
R6970:Fat4 UTSW 3 38,995,971 (GRCm38) missense probably damaging 1.00
R6970:Fat4 UTSW 3 38,981,775 (GRCm38) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,891,543 (GRCm38) missense probably benign
R7030:Fat4 UTSW 3 38,981,958 (GRCm38) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,010,811 (GRCm38) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,010,810 (GRCm38) missense probably benign
R7045:Fat4 UTSW 3 38,888,601 (GRCm38) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,889,874 (GRCm38) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,010,533 (GRCm38) missense probably damaging 1.00
R7130:Fat4 UTSW 3 38,980,787 (GRCm38) missense probably damaging 0.99
R7168:Fat4 UTSW 3 38,980,659 (GRCm38) missense probably damaging 1.00
R7192:Fat4 UTSW 3 38,980,464 (GRCm38) missense probably benign 0.04
R7194:Fat4 UTSW 3 38,983,895 (GRCm38) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,888,884 (GRCm38) missense probably damaging 1.00
R7199:Fat4 UTSW 3 38,977,362 (GRCm38) missense probably damaging 0.98
R7213:Fat4 UTSW 3 38,999,087 (GRCm38) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,891,043 (GRCm38) missense probably damaging 1.00
R7225:Fat4 UTSW 3 38,980,176 (GRCm38) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,890,413 (GRCm38) missense probably benign 0.31
R7239:Fat4 UTSW 3 38,983,840 (GRCm38) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,889,693 (GRCm38) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,889,145 (GRCm38) nonsense probably null
R7372:Fat4 UTSW 3 38,890,209 (GRCm38) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,887,924 (GRCm38) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,000,236 (GRCm38) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,009,644 (GRCm38) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,887,450 (GRCm38) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,009,157 (GRCm38) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38,957,427 (GRCm38) nonsense probably null
R7501:Fat4 UTSW 3 38,958,448 (GRCm38) nonsense probably null
R7533:Fat4 UTSW 3 39,007,257 (GRCm38) missense probably benign 0.43
R7542:Fat4 UTSW 3 38,981,621 (GRCm38) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 38,981,355 (GRCm38) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 38,981,114 (GRCm38) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,889,336 (GRCm38) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,010,241 (GRCm38) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38,981,160 (GRCm38) missense probably benign
R7665:Fat4 UTSW 3 38,889,178 (GRCm38) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,891,697 (GRCm38) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,001,204 (GRCm38) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,887,851 (GRCm38) missense probably benign
R7883:Fat4 UTSW 3 38,981,819 (GRCm38) missense probably damaging 1.00
R7892:Fat4 UTSW 3 38,949,439 (GRCm38) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,887,541 (GRCm38) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,891,721 (GRCm38) missense probably damaging 0.98
R8015:Fat4 UTSW 3 38,981,916 (GRCm38) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38,981,666 (GRCm38) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,891,203 (GRCm38) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,892,054 (GRCm38) missense probably damaging 0.99
R8163:Fat4 UTSW 3 38,979,732 (GRCm38) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38,958,510 (GRCm38) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,008,979 (GRCm38) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 38,979,675 (GRCm38) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 38,981,553 (GRCm38) missense probably benign 0.25
R8509:Fat4 UTSW 3 38,981,903 (GRCm38) missense probably benign
R8543:Fat4 UTSW 3 38,977,494 (GRCm38) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,010,693 (GRCm38) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,010,498 (GRCm38) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,888,443 (GRCm38) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,891,853 (GRCm38) missense probably benign 0.01
R8779:Fat4 UTSW 3 38,979,749 (GRCm38) missense probably damaging 1.00
R8797:Fat4 UTSW 3 38,999,129 (GRCm38) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,892,120 (GRCm38) missense probably benign 0.26
R8955:Fat4 UTSW 3 38,983,629 (GRCm38) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,887,175 (GRCm38) nonsense probably null
R9071:Fat4 UTSW 3 38,983,449 (GRCm38) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,007,299 (GRCm38) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,010,654 (GRCm38) missense
R9180:Fat4 UTSW 3 38,888,407 (GRCm38) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 38,982,443 (GRCm38) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,890,930 (GRCm38) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,009,241 (GRCm38) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,888,247 (GRCm38) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,891,022 (GRCm38) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,891,632 (GRCm38) missense probably damaging 0.98
R9355:Fat4 UTSW 3 38,981,898 (GRCm38) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,891,268 (GRCm38) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,891,263 (GRCm38) missense
R9456:Fat4 UTSW 3 38,888,422 (GRCm38) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 38,983,737 (GRCm38) missense probably benign 0.04
R9510:Fat4 UTSW 3 38,983,737 (GRCm38) missense probably benign 0.04
R9511:Fat4 UTSW 3 38,980,653 (GRCm38) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,009,197 (GRCm38) missense probably benign
R9568:Fat4 UTSW 3 38,892,007 (GRCm38) missense probably damaging 1.00
R9646:Fat4 UTSW 3 38,981,664 (GRCm38) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,889,183 (GRCm38) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,001,225 (GRCm38) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,009,106 (GRCm38) missense probably benign 0.00
X0019:Fat4 UTSW 3 38,981,040 (GRCm38) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,000,151 (GRCm38) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,942,902 (GRCm38) missense probably benign 0.43
X0064:Fat4 UTSW 3 38,970,752 (GRCm38) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38,958,492 (GRCm38) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,887,050 (GRCm38) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 38,983,815 (GRCm38) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 38,983,359 (GRCm38) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,890,347 (GRCm38) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,888,584 (GRCm38) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,981,838 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATAGTGGACACAAGTCTTCC -3'
(R):5'- TCACATTACTGAAGCCACTGAC -3'

Sequencing Primer
(F):5'- GTGGACACAAGTCTTCCATTTAC -3'
(R):5'- AAAATCTCTCCAGTGGTGGC -3'
Posted On 2015-01-23