Incidental Mutation 'R2883:Srrm1'
ID260907
Institutional Source Beutler Lab
Gene Symbol Srrm1
Ensembl Gene ENSMUSG00000028809
Gene Nameserine/arginine repetitive matrix 1
SynonymsSRm160
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135320484-135353321 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 135321411 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030613] [ENSMUST00000084846] [ENSMUST00000105861] [ENSMUST00000136342]
Predicted Effect probably benign
Transcript: ENSMUST00000030613
SMART Domains Protein: ENSMUSP00000030613
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 4.31e-5 PROSPERO
internal_repeat_1 427 456 3.46e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 3.46e-6 PROSPERO
internal_repeat_3 670 693 4.31e-5 PROSPERO
internal_repeat_4 684 698 4.31e-5 PROSPERO
internal_repeat_2 689 734 4.31e-5 PROSPERO
internal_repeat_3 719 740 4.31e-5 PROSPERO
internal_repeat_5 730 740 8.09e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 4.31e-5 PROSPERO
internal_repeat_5 808 818 8.09e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000084846
AA Change: E898G
SMART Domains Protein: ENSMUSP00000081906
Gene: ENSMUSG00000028809
AA Change: E898G

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 402 N/A INTRINSIC
internal_repeat_2 404 450 3.57e-5 PROSPERO
internal_repeat_1 422 451 2.79e-6 PROSPERO
low complexity region 471 495 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 550 656 N/A INTRINSIC
internal_repeat_1 661 695 2.79e-6 PROSPERO
internal_repeat_3 665 688 3.57e-5 PROSPERO
internal_repeat_4 679 693 3.57e-5 PROSPERO
internal_repeat_2 684 729 3.57e-5 PROSPERO
internal_repeat_3 714 735 3.57e-5 PROSPERO
internal_repeat_5 725 735 6.75e-5 PROSPERO
low complexity region 741 790 N/A INTRINSIC
internal_repeat_4 794 808 3.57e-5 PROSPERO
internal_repeat_5 803 813 6.75e-5 PROSPERO
low complexity region 822 846 N/A INTRINSIC
low complexity region 849 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105861
AA Change: E889G
SMART Domains Protein: ENSMUSP00000101487
Gene: ENSMUSG00000028809
AA Change: E889G

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 1.99e-5 PROSPERO
internal_repeat_1 427 456 1.45e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 539 647 N/A INTRINSIC
internal_repeat_1 652 686 1.45e-6 PROSPERO
internal_repeat_3 656 679 1.99e-5 PROSPERO
internal_repeat_4 670 684 1.99e-5 PROSPERO
internal_repeat_2 675 720 1.99e-5 PROSPERO
internal_repeat_3 705 726 1.99e-5 PROSPERO
internal_repeat_5 716 726 3.82e-5 PROSPERO
low complexity region 732 781 N/A INTRINSIC
internal_repeat_4 785 799 1.99e-5 PROSPERO
internal_repeat_5 794 804 3.82e-5 PROSPERO
low complexity region 813 837 N/A INTRINSIC
low complexity region 840 877 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136342
AA Change: E903G
SMART Domains Protein: ENSMUSP00000125003
Gene: ENSMUSG00000028809
AA Change: E903G

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 3.36e-5 PROSPERO
internal_repeat_1 427 456 2.61e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 2.61e-6 PROSPERO
internal_repeat_3 670 693 3.36e-5 PROSPERO
internal_repeat_4 684 698 3.36e-5 PROSPERO
internal_repeat_2 689 734 3.36e-5 PROSPERO
internal_repeat_3 719 740 3.36e-5 PROSPERO
internal_repeat_5 730 740 6.37e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 3.36e-5 PROSPERO
internal_repeat_5 808 818 6.37e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136570
Predicted Effect probably benign
Transcript: ENSMUST00000140050
SMART Domains Protein: ENSMUSP00000120952
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 2 107 N/A INTRINSIC
internal_repeat_1 116 145 9.96e-7 PROSPERO
internal_repeat_1 165 196 9.96e-7 PROSPERO
low complexity region 202 225 N/A INTRINSIC
low complexity region 257 281 N/A INTRINSIC
low complexity region 284 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Srrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Srrm1 APN 4 135347207 splice site probably null
IGL02070:Srrm1 APN 4 135325104 missense unknown
IGL02073:Srrm1 APN 4 135325104 missense unknown
IGL02193:Srrm1 APN 4 135325104 missense unknown
IGL02232:Srrm1 APN 4 135353116 start codon destroyed probably null 1.00
IGL02377:Srrm1 APN 4 135325104 missense unknown
IGL02379:Srrm1 APN 4 135325104 missense unknown
IGL02380:Srrm1 APN 4 135325104 missense unknown
IGL02382:Srrm1 APN 4 135325104 missense unknown
IGL02386:Srrm1 APN 4 135325104 missense unknown
IGL02387:Srrm1 APN 4 135325104 missense unknown
IGL02393:Srrm1 APN 4 135321414 unclassified probably benign
IGL02436:Srrm1 APN 4 135325104 missense unknown
IGL02438:Srrm1 APN 4 135325104 missense unknown
IGL02439:Srrm1 APN 4 135325104 missense unknown
IGL02440:Srrm1 APN 4 135325104 missense unknown
IGL02500:Srrm1 APN 4 135325104 missense unknown
IGL02561:Srrm1 APN 4 135325104 missense unknown
IGL02562:Srrm1 APN 4 135325104 missense unknown
IGL02566:Srrm1 APN 4 135325104 missense unknown
IGL02567:Srrm1 APN 4 135325104 missense unknown
IGL02568:Srrm1 APN 4 135325104 missense unknown
IGL02569:Srrm1 APN 4 135325104 missense unknown
IGL02570:Srrm1 APN 4 135325104 missense unknown
IGL02572:Srrm1 APN 4 135325104 missense unknown
IGL02583:Srrm1 APN 4 135325104 missense unknown
IGL02584:Srrm1 APN 4 135325104 missense unknown
IGL02585:Srrm1 APN 4 135325104 missense unknown
IGL02586:Srrm1 APN 4 135325104 missense unknown
IGL02587:Srrm1 APN 4 135325104 missense unknown
IGL02588:Srrm1 APN 4 135325104 missense unknown
IGL02589:Srrm1 APN 4 135325104 missense unknown
IGL02596:Srrm1 APN 4 135325104 missense unknown
IGL02597:Srrm1 APN 4 135325104 missense unknown
IGL02601:Srrm1 APN 4 135325104 missense unknown
IGL02602:Srrm1 APN 4 135325104 missense unknown
IGL02609:Srrm1 APN 4 135325104 missense unknown
IGL02614:Srrm1 APN 4 135325104 missense unknown
IGL02631:Srrm1 APN 4 135325104 missense unknown
IGL02632:Srrm1 APN 4 135325104 missense unknown
IGL02657:Srrm1 APN 4 135325104 missense unknown
IGL02658:Srrm1 APN 4 135325104 missense unknown
IGL02659:Srrm1 APN 4 135325104 missense unknown
IGL02660:Srrm1 APN 4 135325104 missense unknown
IGL02677:Srrm1 APN 4 135325104 missense unknown
IGL02683:Srrm1 APN 4 135325104 missense unknown
IGL02686:Srrm1 APN 4 135325104 missense unknown
IGL02690:Srrm1 APN 4 135325104 missense unknown
IGL02713:Srrm1 APN 4 135325104 missense unknown
IGL02723:Srrm1 APN 4 135325104 missense unknown
IGL02724:Srrm1 APN 4 135325104 missense unknown
IGL02725:Srrm1 APN 4 135325104 missense unknown
IGL02730:Srrm1 APN 4 135325104 missense unknown
IGL02731:Srrm1 APN 4 135325104 missense unknown
IGL02732:Srrm1 APN 4 135325104 missense unknown
IGL02733:Srrm1 APN 4 135325104 missense unknown
IGL02734:Srrm1 APN 4 135325104 missense unknown
IGL02743:Srrm1 APN 4 135325104 missense unknown
IGL02744:Srrm1 APN 4 135325104 missense unknown
IGL02752:Srrm1 APN 4 135325104 missense unknown
Serious UTSW 4 135340926 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0132:Srrm1 UTSW 4 135340573 nonsense probably null
R0510:Srrm1 UTSW 4 135338543 intron probably benign
R0691:Srrm1 UTSW 4 135324991 nonsense probably null
R1337:Srrm1 UTSW 4 135346733 critical splice donor site probably null
R1397:Srrm1 UTSW 4 135321431 unclassified probably benign
R4043:Srrm1 UTSW 4 135340931 unclassified probably benign
R4772:Srrm1 UTSW 4 135342379 unclassified probably benign
R4837:Srrm1 UTSW 4 135345512 intron probably benign
R4975:Srrm1 UTSW 4 135346720 splice site probably benign
R5401:Srrm1 UTSW 4 135324069 splice site probably benign
R6144:Srrm1 UTSW 4 135337873 unclassified probably benign
R6542:Srrm1 UTSW 4 135340926 nonsense probably null
R7147:Srrm1 UTSW 4 135346826 missense probably damaging 0.98
R8054:Srrm1 UTSW 4 135325015 missense unknown
R8371:Srrm1 UTSW 4 135325221 missense unknown
R8523:Srrm1 UTSW 4 135324002 missense unknown
R8767:Srrm1 UTSW 4 135332221 missense unknown
Z1177:Srrm1 UTSW 4 135323998 missense unknown
Z1177:Srrm1 UTSW 4 135331741 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCCTTTGTAATGTAAATCCATGC -3'
(R):5'- CTGATCTTGGCACCATAACAAATTC -3'

Sequencing Primer
(F):5'- ACATGGTGAACTTCAACCTAGC -3'
(R):5'- TCTTGGCACCATAACAAATTCTAAAC -3'
Posted On2015-01-23