Incidental Mutation 'R2883:C1qtnf7'
ID260910
Institutional Source Beutler Lab
Gene Symbol C1qtnf7
Ensembl Gene ENSMUSG00000061535
Gene NameC1q and tumor necrosis factor related protein 7
Synonyms5530401N20Rik, CTRP7, 8430425G24Rik
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43515538-43618803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43615880 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 167 (F167I)
Ref Sequence ENSEMBL: ENSMUSP00000113520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076939] [ENSMUST00000121872]
Predicted Effect probably damaging
Transcript: ENSMUST00000076939
AA Change: F174I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076206
Gene: ENSMUSG00000061535
AA Change: F174I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Collagen 36 93 2.9e-11 PFAM
Pfam:Collagen 82 139 7.4e-11 PFAM
C1Q 141 276 1.05e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121872
AA Change: F167I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113520
Gene: ENSMUSG00000061535
AA Change: F167I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Collagen 36 93 2.9e-11 PFAM
Pfam:Collagen 82 139 7.4e-11 PFAM
C1Q 141 276 1.05e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167522
AA Change: F174I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126974
Gene: ENSMUSG00000061535
AA Change: F174I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 43 100 1.1e-10 PFAM
Pfam:Collagen 89 146 2.8e-10 PFAM
C1Q 148 283 1.05e-45 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased weight, liver fibrosis, male-specific glucose serum levels and adipose inflammation with male-specific improved glucose tolerance when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in C1qtnf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:C1qtnf7 APN 5 43609260 missense possibly damaging 0.92
IGL01411:C1qtnf7 APN 5 43609061 start codon destroyed probably benign 0.01
R1464:C1qtnf7 UTSW 5 43609139 missense probably benign 0.18
R1464:C1qtnf7 UTSW 5 43609139 missense probably benign 0.18
R1630:C1qtnf7 UTSW 5 43609161 missense possibly damaging 0.73
R4441:C1qtnf7 UTSW 5 43609270 missense possibly damaging 0.85
R4569:C1qtnf7 UTSW 5 43609207 missense possibly damaging 0.85
R5101:C1qtnf7 UTSW 5 43615972 nonsense probably null
R5180:C1qtnf7 UTSW 5 43615814 missense probably benign 0.19
R5596:C1qtnf7 UTSW 5 43515970 start gained probably benign
R5886:C1qtnf7 UTSW 5 43615656 missense probably damaging 1.00
R5997:C1qtnf7 UTSW 5 43616085 missense probably damaging 1.00
R6830:C1qtnf7 UTSW 5 43609094 missense possibly damaging 0.53
R6971:C1qtnf7 UTSW 5 43609050 splice site probably null
R7615:C1qtnf7 UTSW 5 43616144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTGGTGAGAAAGGAGACC -3'
(R):5'- GGCATCAAAGGTCCTTATCCG -3'

Sequencing Primer
(F):5'- GACCCATAGGACCAGAGGG -3'
(R):5'- ATCAAAGGTCCTTATCCGGTACTG -3'
Posted On2015-01-23