Incidental Mutation 'R2883:Supt5'
ID260915
Institutional Source Beutler Lab
Gene Symbol Supt5
Ensembl Gene ENSMUSG00000003435
Gene Namesuppressor of Ty 5
SynonymsSupt5h, Spt5
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28314891-28338746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28329320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 153 (Y153H)
Ref Sequence ENSEMBL: ENSMUSP00000147164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003527] [ENSMUST00000207563] [ENSMUST00000208243] [ENSMUST00000209141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003527
AA Change: Y153H

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003527
Gene: ENSMUSG00000003435
AA Change: Y153H

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 36 63 N/A INTRINSIC
Pfam:Spt5_N 73 170 8.1e-17 PFAM
NGN 174 265 2.2e-14 SMART
KOW 270 297 8.77e0 SMART
KOW 417 444 8.69e-4 SMART
KOW 469 496 9.1e-7 SMART
KOW 591 618 2.46e-3 SMART
low complexity region 677 695 N/A INTRINSIC
KOW 697 724 3.93e-2 SMART
CTD 766 902 2.09e-31 SMART
KOW 1028 1055 9.69e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207879
Predicted Effect possibly damaging
Transcript: ENSMUST00000208243
AA Change: Y5H

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208726
Predicted Effect possibly damaging
Transcript: ENSMUST00000209141
AA Change: Y153H

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Supt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Supt5 APN 7 28315382 missense probably benign 0.08
IGL01077:Supt5 APN 7 28323788 nonsense probably null
IGL01477:Supt5 APN 7 28317264 missense possibly damaging 0.94
IGL01813:Supt5 APN 7 28323975 missense probably damaging 0.99
IGL02405:Supt5 APN 7 28315824 missense probably benign 0.00
IGL02525:Supt5 APN 7 28318947 splice site probably benign
IGL02584:Supt5 APN 7 28326167 missense probably benign 0.08
IGL03387:Supt5 APN 7 28320083 missense possibly damaging 0.89
R0420:Supt5 UTSW 7 28317329 splice site probably benign
R0715:Supt5 UTSW 7 28329037 missense probably damaging 1.00
R1226:Supt5 UTSW 7 28328747 missense probably benign 0.03
R1655:Supt5 UTSW 7 28330024 missense probably benign 0.00
R1801:Supt5 UTSW 7 28317214 critical splice donor site probably null
R2424:Supt5 UTSW 7 28315165 missense possibly damaging 0.47
R4280:Supt5 UTSW 7 28317073 missense probably damaging 1.00
R4614:Supt5 UTSW 7 28325972 missense possibly damaging 0.65
R4792:Supt5 UTSW 7 28316329 missense probably benign 0.19
R4997:Supt5 UTSW 7 28316037 missense probably benign 0.05
R5041:Supt5 UTSW 7 28315380 missense probably damaging 1.00
R5062:Supt5 UTSW 7 28329015 splice site probably null
R5119:Supt5 UTSW 7 28316370 missense probably damaging 1.00
R5170:Supt5 UTSW 7 28316083 missense probably benign 0.05
R5687:Supt5 UTSW 7 28317763 missense probably benign 0.27
R5720:Supt5 UTSW 7 28322568 missense probably damaging 0.97
R5935:Supt5 UTSW 7 28329475 missense probably benign 0.09
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6032:Supt5 UTSW 7 28316175 missense probably damaging 1.00
R6049:Supt5 UTSW 7 28315197 missense probably benign 0.32
R7043:Supt5 UTSW 7 28320010 missense probably benign 0.00
R7085:Supt5 UTSW 7 28331489 missense unknown
R7152:Supt5 UTSW 7 28323900 missense probably benign 0.00
R7201:Supt5 UTSW 7 28316788 missense probably benign 0.03
R7401:Supt5 UTSW 7 28323772 missense probably damaging 0.99
R7959:Supt5 UTSW 7 28315799 missense probably benign 0.43
R8181:Supt5 UTSW 7 28331474 missense unknown
Z1177:Supt5 UTSW 7 28317031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCAGACCTGTCTCCTCACTAAG -3'
(R):5'- AGCTTCCTTGGACAGATGTGG -3'

Sequencing Primer
(F):5'- AGACCTGTCTCCTCACTAAGTCATG -3'
(R):5'- GGGCAGACTGACTTTCCTTCATG -3'
Posted On2015-01-23