Incidental Mutation 'R2883:Rora'
ID260920
Institutional Source Beutler Lab
Gene Symbol Rora
Ensembl Gene ENSMUSG00000032238
Gene NameRAR-related orphan receptor alpha
Synonymstmgc26, Nr1f1, 9530021D13Rik
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location68653786-69388246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69375435 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 356 (S356P)
Ref Sequence ENSEMBL: ENSMUSP00000109254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034766] [ENSMUST00000113624]
Predicted Effect probably damaging
Transcript: ENSMUST00000034766
AA Change: S412P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034766
Gene: ENSMUSG00000032238
AA Change: S412P

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
ZnF_C4 70 141 4.71e-41 SMART
low complexity region 161 175 N/A INTRINSIC
HOLI 325 481 8.8e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113624
AA Change: S356P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109254
Gene: ENSMUSG00000032238
AA Change: S356P

DomainStartEndE-ValueType
ZnF_C4 14 85 4.71e-41 SMART
low complexity region 105 119 N/A INTRINSIC
HOLI 269 425 8.8e-32 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for null mutations exhibit ataxia, cerebellar dysgenesis, impaired Purkinje and granule cell development, olfactory defects, hypoalphalipoproteinemia, and death around 4 weeks. Heterozygotes show slow Purkinje cell dedritic atrophy and loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Rora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Rora APN 9 69371290 missense probably benign 0.31
IGL02355:Rora APN 9 69374092 missense probably damaging 1.00
IGL02362:Rora APN 9 69374092 missense probably damaging 1.00
PIT4696001:Rora UTSW 9 69364559 missense possibly damaging 0.92
R0091:Rora UTSW 9 69374048 missense probably damaging 1.00
R0555:Rora UTSW 9 69361746 missense probably damaging 1.00
R0609:Rora UTSW 9 69361869 missense probably damaging 1.00
R1483:Rora UTSW 9 69364385 missense probably benign 0.00
R1712:Rora UTSW 9 69375489 missense probably benign 0.23
R1785:Rora UTSW 9 69376837 missense probably benign 0.30
R4173:Rora UTSW 9 68653910 missense probably benign 0.41
R5226:Rora UTSW 9 69364141 intron probably benign
R5660:Rora UTSW 9 68653921 missense probably benign 0.27
R6029:Rora UTSW 9 69364452 missense probably benign 0.04
R6054:Rora UTSW 9 69378802 missense probably benign 0.04
R6114:Rora UTSW 9 69371323 missense probably benign
R6329:Rora UTSW 9 69373186 missense probably damaging 1.00
R7028:Rora UTSW 9 69196083 missense possibly damaging 0.46
R7170:Rora UTSW 9 69373190 nonsense probably null
R7233:Rora UTSW 9 69197522 nonsense probably null
R7512:Rora UTSW 9 69374085 missense probably benign 0.00
Z1176:Rora UTSW 9 69364372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAATGGTGATGTTGGCTAAGC -3'
(R):5'- TAATAAGGGTGGCAGCTGC -3'

Sequencing Primer
(F):5'- TCCCTCTTAATGCTTCAAAAGTCAAC -3'
(R):5'- TAATAAGGGTGGCAGCTGCTCTTG -3'
Posted On2015-01-23