Mutagenetix > Incidental Mutation

Incidental Mutation 'R2883:Ranbp17'

260930

Institutional Source

Beutler Lab

Gene Symbol

Ranbp17

Ensembl Gene

ENSMUSG00000040594

Gene Name

RAN binding protein 17

Synonyms

4932704E15Rik

MMRRC Submission

040471-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33211795-33513746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33504708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 42 (C42R)

Ref Sequence

ENSEMBL: ENSMUSP00000118519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179] [ENSMUST00000147751]

AlphaFold

Q99NF8

Predicted Effect

probably damaging
Transcript: ENSMUST00000037522
AA Change: C47R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594
AA Change: C47R

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102815
AA Change: C47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: C47R

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129179
AA Change: C47R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594
AA Change: C47R

Domain	Start	End	E-Value	Type
IBN_N	30	95	3.24e-5	SMART
low complexity region	270	283	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000147751
AA Change: C42R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118519
Gene: ENSMUSG00000040594
AA Change: C42R

Domain	Start	End	E-Value	Type
IBN_N	25	90	3.24e-5	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	C	A	17: 47,436,725	V32F	probably damaging	Het
1700018B08Rik	G	A	8: 121,539,905	P81S	probably damaging	Het
Arhgef10l	T	C	4: 140,516,802	Q790R	probably benign	Het
Asic2	T	A	11: 80,894,013	I367F	possibly damaging	Het
Asxl2	T	C	12: 3,501,830	S1191P	probably benign	Het
Bod1l	A	G	5: 41,832,259	S374P	probably benign	Het
C1qtnf7	T	A	5: 43,615,880	F167I	probably damaging	Het
Col13a1	A	G	10: 61,978,356	L94P	probably benign	Het
Cped1	A	T	6: 22,143,979	T575S	probably damaging	Het
Cpt1b	T	C	15: 89,417,869	Y702C	probably benign	Het
D630039A03Rik	T	A	4: 57,910,560	N84I	probably damaging	Het
Dse	A	T	10: 34,152,507	D862E	probably benign	Het
Etl4	A	T	2: 20,806,174	T1023S	possibly damaging	Het
Fat4	T	A	3: 38,980,804	N2868K	probably damaging	Het
Fgd5	G	A	6: 91,987,109		probably null	Het
Fsip2	C	T	2: 82,991,524	T5867I	possibly damaging	Het
Fuca2	A	G	10: 13,505,951	T203A	probably benign	Het
Gli2	T	C	1: 118,868,144	I131V	probably damaging	Het
Gtpbp4	A	G	13: 8,990,723	V122A	possibly damaging	Het
Kif1b	G	A	4: 149,237,648	T938I	possibly damaging	Het
Klhl29	T	C	12: 5,084,036	D767G	probably damaging	Het
Mageb3	A	G	2: 121,954,366	V285A	probably benign	Het
Myoc	A	G	1: 162,639,616	E118G	possibly damaging	Het
Nedd1	A	C	10: 92,694,998	F410V	probably damaging	Het
Nipal1	A	T	5: 72,667,730	K255N	probably damaging	Het
Npr3	T	C	15: 11,883,324	K340E	possibly damaging	Het
Obsl1	C	A	1: 75,496,511	G1023C	possibly damaging	Het
Ogdh	T	C	11: 6,334,545	L188P	probably damaging	Het
Olfr110	C	T	17: 37,499,380	S243F	probably damaging	Het
Olfr1500	T	A	19: 13,827,875	I174F	probably damaging	Het
Olfr616	T	C	7: 103,565,264	N5S	probably benign	Het
Otogl	G	A	10: 107,768,981	T2188M	probably damaging	Het
Pck1	G	A	2: 173,158,575	V600I	probably benign	Het
Rapgef4	G	A	2: 72,031,125	R53H	probably benign	Het
Rbm12	G	A	2: 156,097,075	H426Y	probably damaging	Het
Retreg2	C	T	1: 75,146,712	P428L	probably benign	Het
Rev3l	G	T	10: 39,825,156	S1883I	probably damaging	Het
Rinl	CGGG	CGGGGG	7: 28,797,658		probably null	Het
Rora	T	C	9: 69,375,435	S356P	probably damaging	Het
Slc31a1	T	C	4: 62,388,771	V188A	probably damaging	Het
Slc9a3	A	G	13: 74,158,760	K335E	probably damaging	Het
Spata22	C	A	11: 73,344,678	H274N	possibly damaging	Het
Srrm1	T	C	4: 135,321,411		probably benign	Het
Stab2	A	T	10: 86,967,686	I333N	possibly damaging	Het
Supt5	A	G	7: 28,329,320	Y153H	possibly damaging	Het
Tyk2	T	C	9: 21,110,587	T825A	probably benign	Het
Usp20	G	A	2: 31,018,800	V798M	probably benign	Het
Wdr26	A	T	1: 181,211,120	D102E	probably damaging	Het

Other mutations in Ranbp17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Ranbp17	APN	11	33493402	missense	probably benign	0.13
IGL00582:Ranbp17	APN	11	33504683	missense	probably damaging	0.99
IGL00698:Ranbp17	APN	11	33441910	missense	probably benign	0.00
IGL00789:Ranbp17	APN	11	33243249	missense	probably benign	0.27
IGL01304:Ranbp17	APN	11	33266147	missense	possibly damaging	0.91
IGL01936:Ranbp17	APN	11	33487689	missense	probably benign	0.00
IGL01937:Ranbp17	APN	11	33328520	missense	possibly damaging	0.73
IGL01945:Ranbp17	APN	11	33328520	missense	possibly damaging	0.73
IGL01993:Ranbp17	APN	11	33500770	missense	possibly damaging	0.48
IGL02588:Ranbp17	APN	11	33217361	missense	probably benign
IGL02870:Ranbp17	APN	11	33243262	missense	probably damaging	1.00
IGL03149:Ranbp17	APN	11	33243183	missense	possibly damaging	0.76
PIT4445001:Ranbp17	UTSW	11	33481020	critical splice donor site	probably null
PIT4480001:Ranbp17	UTSW	11	33297340	critical splice donor site	probably null
R0079:Ranbp17	UTSW	11	33500682	missense	probably damaging	1.00
R0349:Ranbp17	UTSW	11	33500689	missense	probably benign
R0395:Ranbp17	UTSW	11	33474896	missense	probably benign
R1456:Ranbp17	UTSW	11	33266310	missense	probably damaging	1.00
R1539:Ranbp17	UTSW	11	33297394	missense	probably damaging	0.99
R1542:Ranbp17	UTSW	11	33264672	missense	probably benign
R1770:Ranbp17	UTSW	11	33217301	missense	probably benign	0.31
R2216:Ranbp17	UTSW	11	33481125	missense	probably damaging	1.00
R2656:Ranbp17	UTSW	11	33243122	missense	probably benign
R3498:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3499:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3721:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3788:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3790:Ranbp17	UTSW	11	33219203	small deletion	probably benign
R3914:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R3915:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R3949:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4021:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4022:Ranbp17	UTSW	11	33479189	missense	probably benign	0.02
R4027:Ranbp17	UTSW	11	33500718	missense	possibly damaging	0.67
R4421:Ranbp17	UTSW	11	33475056	missense	probably benign	0.01
R4462:Ranbp17	UTSW	11	33217421	critical splice acceptor site	probably null
R4659:Ranbp17	UTSW	11	33266288	missense	probably damaging	1.00
R4791:Ranbp17	UTSW	11	33487746	missense	probably benign	0.11
R4837:Ranbp17	UTSW	11	33328451	missense	probably damaging	1.00
R4914:Ranbp17	UTSW	11	33213425	missense	probably benign
R4939:Ranbp17	UTSW	11	33219223	missense	probably benign	0.31
R5119:Ranbp17	UTSW	11	33404181	makesense	probably null
R5171:Ranbp17	UTSW	11	33217419	missense	probably benign
R5182:Ranbp17	UTSW	11	33219287	intron	probably benign
R5288:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5384:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5385:Ranbp17	UTSW	11	33219241	missense	possibly damaging	0.75
R5398:Ranbp17	UTSW	11	33474998	missense	probably damaging	1.00
R6658:Ranbp17	UTSW	11	33219214	nonsense	probably null
R6701:Ranbp17	UTSW	11	33475066	missense	probably damaging	1.00
R6796:Ranbp17	UTSW	11	33217398	missense	probably benign
R6869:Ranbp17	UTSW	11	33513074	start gained	probably benign
R7096:Ranbp17	UTSW	11	33474896	missense	probably benign
R7156:Ranbp17	UTSW	11	33297420	missense	probably damaging	1.00
R7451:Ranbp17	UTSW	11	33284114	splice site	probably null
R7958:Ranbp17	UTSW	11	33487702	missense	probably damaging	1.00
R9348:Ranbp17	UTSW	11	33479232	missense	probably benign	0.01
R9529:Ranbp17	UTSW	11	33474826	missense	unknown
RF016:Ranbp17	UTSW	11	33329511	missense	probably damaging	0.99
X0013:Ranbp17	UTSW	11	33289562	splice site	probably null
X0024:Ranbp17	UTSW	11	33213404	makesense	probably null
Z1176:Ranbp17	UTSW	11	33481108	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGACATAAAACCAGGCCAAG -3'
(R):5'- CTGCTCAGTACCTATGCATTGC -3'

Sequencing Primer
(F):5'- ATATGCCTATTTCTACTTTGTGGCTG -3'
(R):5'- TGCATTGCATGGATGTATAGAAGC -3'

Posted On

2015-01-23