Incidental Mutation 'R2883:Asxl2'
ID260934
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission 040471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3501830 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1191 (S1191P)
Ref Sequence ENSEMBL: ENSMUSP00000106846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000153102]
Predicted Effect probably benign
Transcript: ENSMUST00000092003
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111215
AA Change: S1191P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486
AA Change: S1191P

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152196
Predicted Effect probably benign
Transcript: ENSMUST00000153102
AA Change: S1191P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486
AA Change: S1191P

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219208
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
Blinder UTSW 12 3442529 missense probably damaging 0.99
Fob UTSW 12 3484531 missense probably damaging 1.00
peaky UTSW 12 3476040 missense possibly damaging 0.91
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0584:Asxl2 UTSW 12 3496632 missense probably damaging 0.96
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5611:Asxl2 UTSW 12 3484598 missense probably damaging 1.00
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6405:Asxl2 UTSW 12 3493758 missense probably damaging 0.99
R6938:Asxl2 UTSW 12 3476149 missense probably damaging 0.98
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R7438:Asxl2 UTSW 12 3427108 start gained probably benign
R7980:Asxl2 UTSW 12 3496630 missense probably damaging 0.99
R7991:Asxl2 UTSW 12 3484531 missense probably damaging 1.00
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
R8156:Asxl2 UTSW 12 3496760 missense probably benign 0.09
R8396:Asxl2 UTSW 12 3502220 missense probably benign
R8773:Asxl2 UTSW 12 3457200 missense probably damaging 0.97
R8792:Asxl2 UTSW 12 3496536 missense probably benign 0.00
R8827:Asxl2 UTSW 12 3500501 missense probably benign
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATTTCAGTGAAGGAGGAGCC -3'
(R):5'- CATGCCTCTATAGCTTGGCC -3'

Sequencing Primer
(F):5'- CAGTGAAGGAGGAGCCATGGG -3'
(R):5'- CCATACAATTTGGGGGTTTGCAG -3'
Posted On2015-01-23