Mutagenetix > Incidental Mutations

Incidental Mutation 'R2883:Klhl29'

260935

Institutional Source

Beutler Lab

Gene Symbol

Klhl29

Ensembl Gene

ENSMUSG00000020627

Gene Name

kelch-like 29

Synonyms

A230106N14Rik, Kbtbd9

MMRRC Submission

040471-MU

Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R2883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5077472-5375682 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5084036 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 767 (D767G)

Ref Sequence

ENSEMBL: ENSMUSP00000020958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020958
AA Change: D767G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: D767G

Domain	Start	End	E-Value	Type
low complexity region	30	49	N/A	INTRINSIC
low complexity region	50	75	N/A	INTRINSIC
low complexity region	80	94	N/A	INTRINSIC
low complexity region	205	219	N/A	INTRINSIC
low complexity region	260	280	N/A	INTRINSIC
BTB	329	431	2.07e-22	SMART
BACK	436	538	4.88e-32	SMART
Kelch	585	636	5.33e0	SMART
Kelch	637	683	5.42e-5	SMART
Kelch	684	730	5.42e-5	SMART
Kelch	731	778	5.44e-1	SMART
Kelch	779	821	2.54e-1	SMART
Kelch	822	870	4.01e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218384
AA Change: D706G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	C	A	17: 47,436,725	V32F	probably damaging	Het
1700018B08Rik	G	A	8: 121,539,905	P81S	probably damaging	Het
Arhgef10l	T	C	4: 140,516,802	Q790R	probably benign	Het
Asic2	T	A	11: 80,894,013	I367F	possibly damaging	Het
Asxl2	T	C	12: 3,501,830	S1191P	probably benign	Het
Bod1l	A	G	5: 41,832,259	S374P	probably benign	Het
C1qtnf7	T	A	5: 43,615,880	F167I	probably damaging	Het
Col13a1	A	G	10: 61,978,356	L94P	probably benign	Het
Cped1	A	T	6: 22,143,979	T575S	probably damaging	Het
Cpt1b	T	C	15: 89,417,869	Y702C	probably benign	Het
D630039A03Rik	T	A	4: 57,910,560	N84I	probably damaging	Het
Dse	A	T	10: 34,152,507	D862E	probably benign	Het
Etl4	A	T	2: 20,806,174	T1023S	possibly damaging	Het
Fat4	T	A	3: 38,980,804	N2868K	probably damaging	Het
Fgd5	G	A	6: 91,987,109		probably null	Het
Fsip2	C	T	2: 82,991,524	T5867I	possibly damaging	Het
Fuca2	A	G	10: 13,505,951	T203A	probably benign	Het
Gli2	T	C	1: 118,868,144	I131V	probably damaging	Het
Gtpbp4	A	G	13: 8,990,723	V122A	possibly damaging	Het
Kif1b	G	A	4: 149,237,648	T938I	possibly damaging	Het
Mageb3	A	G	2: 121,954,366	V285A	probably benign	Het
Myoc	A	G	1: 162,639,616	E118G	possibly damaging	Het
Nedd1	A	C	10: 92,694,998	F410V	probably damaging	Het
Nipal1	A	T	5: 72,667,730	K255N	probably damaging	Het
Npr3	T	C	15: 11,883,324	K340E	possibly damaging	Het
Obsl1	C	A	1: 75,496,511	G1023C	possibly damaging	Het
Ogdh	T	C	11: 6,334,545	L188P	probably damaging	Het
Olfr110	C	T	17: 37,499,380	S243F	probably damaging	Het
Olfr1500	T	A	19: 13,827,875	I174F	probably damaging	Het
Olfr616	T	C	7: 103,565,264	N5S	probably benign	Het
Otogl	G	A	10: 107,768,981	T2188M	probably damaging	Het
Pck1	G	A	2: 173,158,575	V600I	probably benign	Het
Ranbp17	A	G	11: 33,504,708	C42R	probably damaging	Het
Rapgef4	G	A	2: 72,031,125	R53H	probably benign	Het
Rbm12	G	A	2: 156,097,075	H426Y	probably damaging	Het
Retreg2	C	T	1: 75,146,712	P428L	probably benign	Het
Rev3l	G	T	10: 39,825,156	S1883I	probably damaging	Het
Rinl	CGGG	CGGGGG	7: 28,797,658		probably null	Het
Rora	T	C	9: 69,375,435	S356P	probably damaging	Het
Slc31a1	T	C	4: 62,388,771	V188A	probably damaging	Het
Slc9a3	A	G	13: 74,158,760	K335E	probably damaging	Het
Spata22	C	A	11: 73,344,678	H274N	possibly damaging	Het
Srrm1	T	C	4: 135,321,411		probably benign	Het
Stab2	A	T	10: 86,967,686	I333N	possibly damaging	Het
Supt5	A	G	7: 28,329,320	Y153H	possibly damaging	Het
Tyk2	T	C	9: 21,110,587	T825A	probably benign	Het
Usp20	G	A	2: 31,018,800	V798M	probably benign	Het
Wdr26	A	T	1: 181,211,120	D102E	probably damaging	Het

Other mutations in Klhl29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Klhl29	APN	12	5140705	missense	probably benign	0.01
IGL02639:Klhl29	APN	12	5137453	missense	probably damaging	0.96
IGL03142:Klhl29	APN	12	5137603	missense	probably damaging	1.00
bauxite	UTSW	12	5091347	missense	probably damaging	0.98
mineral	UTSW	12	5083995	missense	probably damaging	0.99
tungsten	UTSW	12	5090995	nonsense	probably null
N/A - 535:Klhl29	UTSW	12	5084019	missense	probably damaging	1.00
R0347:Klhl29	UTSW	12	5084354	missense	probably damaging	0.97
R0622:Klhl29	UTSW	12	5081224	missense	probably damaging	1.00
R0631:Klhl29	UTSW	12	5094883	missense	probably benign	0.08
R0784:Klhl29	UTSW	12	5081251	missense	probably damaging	1.00
R1157:Klhl29	UTSW	12	5090650	missense	possibly damaging	0.89
R1521:Klhl29	UTSW	12	5091307	missense	probably damaging	1.00
R1535:Klhl29	UTSW	12	5084486	missense	probably damaging	1.00
R1599:Klhl29	UTSW	12	5093538	missense	probably damaging	1.00
R2049:Klhl29	UTSW	12	5137876	missense	probably damaging	0.96
R2568:Klhl29	UTSW	12	5091350	missense	probably damaging	0.96
R3724:Klhl29	UTSW	12	5090603	missense	probably damaging	0.99
R3951:Klhl29	UTSW	12	5140660	missense	probably damaging	1.00
R5031:Klhl29	UTSW	12	5091334	missense	probably benign	0.05
R5078:Klhl29	UTSW	12	5093530	missense	possibly damaging	0.82
R5410:Klhl29	UTSW	12	5091366	missense	probably benign	0.36
R5619:Klhl29	UTSW	12	5140587	missense	probably benign	0.23
R5681:Klhl29	UTSW	12	5090669	missense	possibly damaging	0.56
R6028:Klhl29	UTSW	12	5090995	nonsense	probably null
R6294:Klhl29	UTSW	12	5083995	missense	probably damaging	0.99
R6394:Klhl29	UTSW	12	5094830	nonsense	probably null
R6394:Klhl29	UTSW	12	5137720	missense	probably benign	0.00
R6475:Klhl29	UTSW	12	5091030	missense	probably damaging	0.98
R6737:Klhl29	UTSW	12	5210124	missense	possibly damaging	0.68
R6781:Klhl29	UTSW	12	5091347	missense	probably damaging	0.98
R6788:Klhl29	UTSW	12	5084393	missense	probably damaging	1.00
R7741:Klhl29	UTSW	12	5137500	missense	possibly damaging	0.49
Z1177:Klhl29	UTSW	12	5081152	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TGATGTGGTTACTTGTGCACCC -3'
(R):5'- TGTAGGTAACCCCAAAGCCC -3'

Sequencing Primer
(F):5'- GCCTCACTCCTTCAGAACC -3'
(R):5'- CCAAAGCCCAGGTGTGATG -3'

Posted On

2015-01-23