Incidental Mutation 'R2883:Klhl29'
ID260935
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Namekelch-like 29
SynonymsA230106N14Rik, Kbtbd9
MMRRC Submission 040471-MU
Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location5077472-5375682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5084036 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 767 (D767G)
Ref Sequence ENSEMBL: ENSMUSP00000020958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
Predicted Effect probably damaging
Transcript: ENSMUST00000020958
AA Change: D767G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: D767G

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218384
AA Change: D706G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr110 C T 17: 37,499,380 S243F probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5140705 missense probably benign 0.01
IGL02639:Klhl29 APN 12 5137453 missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5137603 missense probably damaging 1.00
bauxite UTSW 12 5091347 missense probably damaging 0.98
mineral UTSW 12 5083995 missense probably damaging 0.99
tungsten UTSW 12 5090995 nonsense probably null
N/A - 535:Klhl29 UTSW 12 5084019 missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5084354 missense probably damaging 0.97
R0622:Klhl29 UTSW 12 5081224 missense probably damaging 1.00
R0631:Klhl29 UTSW 12 5094883 missense probably benign 0.08
R0784:Klhl29 UTSW 12 5081251 missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5090650 missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5091307 missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5084486 missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5093538 missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5137876 missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5091350 missense probably damaging 0.96
R3724:Klhl29 UTSW 12 5090603 missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5140660 missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5091334 missense probably benign 0.05
R5078:Klhl29 UTSW 12 5093530 missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5091366 missense probably benign 0.36
R5619:Klhl29 UTSW 12 5140587 missense probably benign 0.23
R5681:Klhl29 UTSW 12 5090669 missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5090995 nonsense probably null
R6294:Klhl29 UTSW 12 5083995 missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5094830 nonsense probably null
R6394:Klhl29 UTSW 12 5137720 missense probably benign 0.00
R6475:Klhl29 UTSW 12 5091030 missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5210124 missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5091347 missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5084393 missense probably damaging 1.00
R7741:Klhl29 UTSW 12 5137500 missense possibly damaging 0.49
Z1177:Klhl29 UTSW 12 5081152 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGATGTGGTTACTTGTGCACCC -3'
(R):5'- TGTAGGTAACCCCAAAGCCC -3'

Sequencing Primer
(F):5'- GCCTCACTCCTTCAGAACC -3'
(R):5'- CCAAAGCCCAGGTGTGATG -3'
Posted On2015-01-23