Incidental Mutation 'R2883:Olfr110'
ID260942
Institutional Source Beutler Lab
Gene Symbol Olfr110
Ensembl Gene ENSMUSG00000090894
Gene Nameolfactory receptor 110
SynonymsGA_x6K02T2PSCP-1956307-1957260, MOR249-2
MMRRC Submission 040471-MU
Accession Numbers

Genbank: NM_146328.2

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2883 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37492468-37500207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37499380 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 243 (S243F)
Ref Sequence ENSEMBL: ENSMUSP00000149213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168318] [ENSMUST00000216472]
Predicted Effect probably damaging
Transcript: ENSMUST00000168318
AA Change: S243F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131089
Gene: ENSMUSG00000090894
AA Change: S243F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.9e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216472
AA Change: S243F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C A 17: 47,436,725 V32F probably damaging Het
1700018B08Rik G A 8: 121,539,905 P81S probably damaging Het
Arhgef10l T C 4: 140,516,802 Q790R probably benign Het
Asic2 T A 11: 80,894,013 I367F possibly damaging Het
Asxl2 T C 12: 3,501,830 S1191P probably benign Het
Bod1l A G 5: 41,832,259 S374P probably benign Het
C1qtnf7 T A 5: 43,615,880 F167I probably damaging Het
Col13a1 A G 10: 61,978,356 L94P probably benign Het
Cped1 A T 6: 22,143,979 T575S probably damaging Het
Cpt1b T C 15: 89,417,869 Y702C probably benign Het
D630039A03Rik T A 4: 57,910,560 N84I probably damaging Het
Dse A T 10: 34,152,507 D862E probably benign Het
Etl4 A T 2: 20,806,174 T1023S possibly damaging Het
Fat4 T A 3: 38,980,804 N2868K probably damaging Het
Fgd5 G A 6: 91,987,109 probably null Het
Fsip2 C T 2: 82,991,524 T5867I possibly damaging Het
Fuca2 A G 10: 13,505,951 T203A probably benign Het
Gli2 T C 1: 118,868,144 I131V probably damaging Het
Gtpbp4 A G 13: 8,990,723 V122A possibly damaging Het
Kif1b G A 4: 149,237,648 T938I possibly damaging Het
Klhl29 T C 12: 5,084,036 D767G probably damaging Het
Mageb3 A G 2: 121,954,366 V285A probably benign Het
Myoc A G 1: 162,639,616 E118G possibly damaging Het
Nedd1 A C 10: 92,694,998 F410V probably damaging Het
Nipal1 A T 5: 72,667,730 K255N probably damaging Het
Npr3 T C 15: 11,883,324 K340E possibly damaging Het
Obsl1 C A 1: 75,496,511 G1023C possibly damaging Het
Ogdh T C 11: 6,334,545 L188P probably damaging Het
Olfr1500 T A 19: 13,827,875 I174F probably damaging Het
Olfr616 T C 7: 103,565,264 N5S probably benign Het
Otogl G A 10: 107,768,981 T2188M probably damaging Het
Pck1 G A 2: 173,158,575 V600I probably benign Het
Ranbp17 A G 11: 33,504,708 C42R probably damaging Het
Rapgef4 G A 2: 72,031,125 R53H probably benign Het
Rbm12 G A 2: 156,097,075 H426Y probably damaging Het
Retreg2 C T 1: 75,146,712 P428L probably benign Het
Rev3l G T 10: 39,825,156 S1883I probably damaging Het
Rinl CGGG CGGGGG 7: 28,797,658 probably null Het
Rora T C 9: 69,375,435 S356P probably damaging Het
Slc31a1 T C 4: 62,388,771 V188A probably damaging Het
Slc9a3 A G 13: 74,158,760 K335E probably damaging Het
Spata22 C A 11: 73,344,678 H274N possibly damaging Het
Srrm1 T C 4: 135,321,411 probably benign Het
Stab2 A T 10: 86,967,686 I333N possibly damaging Het
Supt5 A G 7: 28,329,320 Y153H possibly damaging Het
Tyk2 T C 9: 21,110,587 T825A probably benign Het
Usp20 G A 2: 31,018,800 V798M probably benign Het
Wdr26 A T 1: 181,211,120 D102E probably damaging Het
Other mutations in Olfr110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Olfr110 APN 17 37498649 utr 5 prime probably benign
IGL03088:Olfr110 APN 17 37498648 utr 5 prime probably benign
F5426:Olfr110 UTSW 17 37499536 missense probably damaging 1.00
R1664:Olfr110 UTSW 17 37499425 missense possibly damaging 0.83
R4011:Olfr110 UTSW 17 37499491 missense possibly damaging 0.79
R4365:Olfr110 UTSW 17 37499379 missense probably damaging 1.00
R4989:Olfr110 UTSW 17 37499126 missense probably benign 0.10
R5442:Olfr110 UTSW 17 37499439 missense probably damaging 1.00
R5577:Olfr110 UTSW 17 37499602 missense probably benign 0.02
R6592:Olfr110 UTSW 17 37499097 missense probably damaging 1.00
R7134:Olfr110 UTSW 17 37498885 missense probably damaging 1.00
R7840:Olfr110 UTSW 17 37498977 missense probably damaging 1.00
R8226:Olfr110 UTSW 17 37498669 missense probably benign 0.16
R8304:Olfr110 UTSW 17 37499370 missense probably damaging 1.00
R8310:Olfr110 UTSW 17 37499257 missense probably benign 0.00
R8435:Olfr110 UTSW 17 37498785 missense probably benign 0.01
R8779:Olfr110 UTSW 17 37498827 missense probably damaging 1.00
R8852:Olfr110 UTSW 17 37499430 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCTGCCCTTTTGTGGTAAC -3'
(R):5'- AGAGAAAACTGGTGGCTGCC -3'

Sequencing Primer
(F):5'- AATTATTTCTTCTGTGACATACCTCC -3'
(R):5'- GGCCTTCACAGCCTCTTTGATG -3'
Posted On2015-01-23