Incidental Mutation 'R2884:Gm19965'
ID260946
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116821583 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 331 (N331K)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect probably benign
Transcript: ENSMUST00000179777
AA Change: N331K

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: N331K

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1335:Gm19965 UTSW 1 116804619 missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116821849 missense probably benign
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6811:Gm19965 UTSW 1 116804079 missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense
R7162:Gm19965 UTSW 1 116822365 missense unknown
R7290:Gm19965 UTSW 1 116821191 missense
R7473:Gm19965 UTSW 1 116821872 missense unknown
R7643:Gm19965 UTSW 1 116822229 missense unknown
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCAGTTCCCTCAAAATCTACTCAGAG -3'
(R):5'- GAGGCATCCCTGTATATATCACAC -3'

Sequencing Primer
(F):5'- TGAGTTTATGGAAGCAATGAAACATG -3'
(R):5'- ACACATGTTCTAGTATACCAGCTATG -3'
Posted On2015-01-23