Incidental Mutation 'R2884:Fam227b'
ID260950
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126100926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 317 (I317N)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably benign
Transcript: ENSMUST00000110446
AA Change: I317N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110448
AA Change: I317N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably benign
Transcript: ENSMUST00000178118
AA Change: I317N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: I317N

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6660:Fam227b UTSW 2 126144307 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAGCCCTAAAGATTGAC -3'
(R):5'- TGCTACAATAGGAGCAGACAACTC -3'

Sequencing Primer
(F):5'- TCGGAGCCCTAAAGATTGACACAAG -3'
(R):5'- ATAGGAGCAGACAACTCTACTTAG -3'
Posted On2015-01-23