Mutagenetix > Incidental Mutation

Incidental Mutation 'R2884:Xrn2'

260952

Institutional Source

Beutler Lab

Gene Symbol

Xrn2

Ensembl Gene

ENSMUSG00000027433

Gene Name

5'-3' exoribonuclease 2

Synonyms

MMRRC Submission

040472-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R2884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

147012996-147078000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 147047656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 653 (V653E)

Ref Sequence

ENSEMBL: ENSMUSP00000028921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028921]

AlphaFold

Q9DBR1

Predicted Effect

probably damaging
Transcript: ENSMUST00000028921
AA Change: V653E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: V653E

Domain	Start	End	E-Value	Type
Pfam:XRN_N	1	254	1.5e-104	PFAM
ZnF_C2HC	262	278	7.99e-1	SMART
low complexity region	415	427	N/A	INTRINSIC
PDB:3FQD\|A	469	785	8e-75	PDB
low complexity region	913	932	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136136

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	G	T	8: 120,145,511	E59D	possibly damaging	Het
Arhgap27	T	C	11: 103,360,843		probably null	Het
BC061237	A	G	14: 44,501,170	R9G	possibly damaging	Het
BC067074	G	T	13: 113,369,191	A2285S	probably benign	Het
BC067074	A	T	13: 113,320,682	Q1087H	probably damaging	Het
Brsk1	A	G	7: 4,691,123		probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dnajb5	A	T	4: 42,957,355	D284V	probably damaging	Het
Dnmt3a	A	G	12: 3,896,132	D329G	probably damaging	Het
Ecd	C	T	14: 20,320,773	G626D	probably damaging	Het
Exoc3l4	A	G	12: 111,428,522	D551G	possibly damaging	Het
Fam227b	A	T	2: 126,100,926	I317N	probably benign	Het
Fam3c	G	A	6: 22,329,582	R49C	probably damaging	Het
Fcrl5	A	G	3: 87,457,391	Y566C	probably damaging	Het
Fras1	A	G	5: 96,700,268	N1779S	probably benign	Het
Gm19965	T	A	1: 116,821,583	N331K	probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
H2-DMa	A	G	17: 34,137,147	N41S	probably damaging	Het
Habp4	A	T	13: 64,182,266	R328S	probably benign	Het
Hexb	C	T	13: 97,183,700	G272D	probably damaging	Het
Hist1h2ae	A	G	13: 23,570,873	I79T	probably damaging	Het
Lilrb4a	A	T	10: 51,491,613	N84Y	probably benign	Het
Mtnr1a	A	G	8: 45,087,268	T89A	probably benign	Het
Myh13	T	A	11: 67,337,643	N336K	probably benign	Het
Naca	T	C	10: 128,041,678		probably benign	Het
Naif1	C	T	2: 32,454,875	P197L	probably benign	Het
Nprl3	A	G	11: 32,248,163	L179P	probably damaging	Het
Nup93	A	G	8: 94,303,638	Y375C	probably damaging	Het
Olfr547	A	G	7: 102,535,232	I162V	probably benign	Het
Pcdha12	G	A	18: 37,020,704	D159N	probably damaging	Het
Plekhs1	G	A	19: 56,470,826	G39R	probably benign	Het
Ppp4r3a	T	C	12: 101,068,677	E53G	probably damaging	Het
Prss48	A	T	3: 85,997,255	M212K	probably benign	Het
Pth	A	T	7: 113,386,028	L46Q	probably damaging	Het
Rin2	A	T	2: 145,860,991	T536S	probably benign	Het
Setx	T	G	2: 29,148,625	C1707W	probably damaging	Het
Stau2	A	T	1: 16,231,066	F519Y	possibly damaging	Het
Syne2	T	G	12: 75,963,759	V2481G	probably benign	Het
Tpte	C	T	8: 22,335,423	Q331*	probably null	Het
Ttn	G	T	2: 76,900,252		probably benign	Het
Utrn	A	T	10: 12,739,361		probably null	Het
Vmn2r82	A	G	10: 79,396,248	I694V	probably benign	Het
Vmn2r88	G	A	14: 51,413,934	C235Y	probably damaging	Het
Znrf3	A	T	11: 5,289,693	D58E	probably damaging	Het

Other mutations in Xrn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Xrn2	APN	2	147036750	missense	probably benign	0.00
IGL00950:Xrn2	APN	2	147028146	nonsense	probably null
IGL01323:Xrn2	APN	2	147034847	splice site	probably benign
IGL01328:Xrn2	APN	2	147029930	missense	possibly damaging	0.90
IGL01545:Xrn2	APN	2	147038179	missense	probably benign
IGL01729:Xrn2	APN	2	147036797	critical splice donor site	probably null
IGL01805:Xrn2	APN	2	147028143	missense	probably damaging	0.98
IGL02326:Xrn2	APN	2	147047713	missense	probably benign	0.32
IGL02332:Xrn2	APN	2	147026590	missense	probably damaging	1.00
IGL02556:Xrn2	APN	2	147038296	splice site	probably benign
IGL02609:Xrn2	APN	2	147050025	missense	probably benign	0.00
IGL02941:Xrn2	APN	2	147026524	missense	probably damaging	1.00
IGL03119:Xrn2	APN	2	147042872	missense	probably damaging	1.00
R0052:Xrn2	UTSW	2	147040965	splice site	probably benign
R0114:Xrn2	UTSW	2	147029779	missense	probably damaging	0.98
R0196:Xrn2	UTSW	2	147047660	missense	probably damaging	0.99
R0799:Xrn2	UTSW	2	147029898	missense	probably benign	0.03
R0991:Xrn2	UTSW	2	147042082	missense	probably benign	0.40
R1444:Xrn2	UTSW	2	147061488	missense	probably damaging	0.99
R1727:Xrn2	UTSW	2	147061516	missense	probably benign	0.00
R1735:Xrn2	UTSW	2	147061423	missense	probably damaging	1.00
R1885:Xrn2	UTSW	2	147049361	nonsense	probably null
R2199:Xrn2	UTSW	2	147024750	missense	probably damaging	0.96
R3730:Xrn2	UTSW	2	147024809	missense	probably benign	0.09
R3771:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3772:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3773:Xrn2	UTSW	2	147061287	missense	probably benign	0.12
R3816:Xrn2	UTSW	2	147028200	missense	probably damaging	1.00
R3927:Xrn2	UTSW	2	147038189	missense	probably benign
R4173:Xrn2	UTSW	2	147047692	missense	probably damaging	0.96
R4659:Xrn2	UTSW	2	147061474	missense	probably benign	0.01
R4928:Xrn2	UTSW	2	147051718	missense	possibly damaging	0.80
R5452:Xrn2	UTSW	2	147024713	critical splice acceptor site	probably null
R5527:Xrn2	UTSW	2	147029755	missense	probably benign	0.02
R6297:Xrn2	UTSW	2	147026570	missense	probably damaging	1.00
R6301:Xrn2	UTSW	2	147063342	missense	probably benign	0.05
R6316:Xrn2	UTSW	2	147042010	missense	probably damaging	1.00
R6705:Xrn2	UTSW	2	147036662	critical splice acceptor site	probably null
R7173:Xrn2	UTSW	2	147042093	missense	probably damaging	1.00
R7408:Xrn2	UTSW	2	147042097	critical splice donor site	probably null
R7412:Xrn2	UTSW	2	147049346	missense	probably damaging	0.99
R7501:Xrn2	UTSW	2	147029756	missense	probably damaging	1.00
R7856:Xrn2	UTSW	2	147068473	splice site	probably null
R8912:Xrn2	UTSW	2	147049993	missense	probably benign	0.04
R8969:Xrn2	UTSW	2	147029384	missense	probably damaging	1.00
R9083:Xrn2	UTSW	2	147038279	missense	probably damaging	1.00
R9179:Xrn2	UTSW	2	147013161	missense	probably benign	0.04
Z1177:Xrn2	UTSW	2	147028206	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGAGCTAATAGTTGGCCTGAG -3'
(R):5'- ATGCCTCCTATATGAGAAACTTTCC -3'

Sequencing Primer
(F):5'- CATTAGTAAGGTGATAGCACTGC -3'
(R):5'- CACATTGATCAAGTGGGC -3'

Posted On

2015-01-23