Incidental Mutation 'R2884:Prss48'
ID260953
Institutional Source Beutler Lab
Gene Symbol Prss48
Ensembl Gene ENSMUSG00000049013
Gene Nameprotease, serine 48
SynonymsGm1019, Esspl
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location85993810-86002491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85997255 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 212 (M212K)
Ref Sequence ENSEMBL: ENSMUSP00000051199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061343]
Predicted Effect probably benign
Transcript: ENSMUST00000061343
AA Change: M212K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051199
Gene: ENSMUSG00000049013
AA Change: M212K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 39 271 9.46e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182969
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Prss48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03334:Prss48 APN 3 85997318 missense probably damaging 1.00
R0554:Prss48 UTSW 3 86000921 missense probably benign 0.06
R1903:Prss48 UTSW 3 85998307 nonsense probably null
R5730:Prss48 UTSW 3 85997256 missense possibly damaging 0.89
R5889:Prss48 UTSW 3 85998185 missense probably damaging 1.00
R6625:Prss48 UTSW 3 85998066 missense probably benign 0.02
R7357:Prss48 UTSW 3 85997221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATACAGGTCAGTTGATTTGTCC -3'
(R):5'- TGATTCTGACTGACTGTTGCC -3'

Sequencing Primer
(F):5'- AGGTCAGTTGATTTGTCCAGCATTAC -3'
(R):5'- TGACTGACTGTTGCCCTGGC -3'
Posted On2015-01-23