Incidental Mutation 'R2884:Fam3c'
ID260958
Institutional Source Beutler Lab
Gene Symbol Fam3c
Ensembl Gene ENSMUSG00000029672
Gene Namefamily with sequence similarity 3, member C
SynonymsFam3c, D6Wsu176e
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22306520-22356243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22329582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 49 (R49C)
Ref Sequence ENSEMBL: ENSMUSP00000128855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081288] [ENSMUST00000163371] [ENSMUST00000163963] [ENSMUST00000165576] [ENSMUST00000168965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081288
AA Change: R19C

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080040
Gene: ENSMUSG00000029672
AA Change: R19C

DomainStartEndE-ValueType
PDB:2YOP|C 18 194 9e-45 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000163371
AA Change: R49C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128855
Gene: ENSMUSG00000029672
AA Change: R49C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163963
AA Change: R69C

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127559
Gene: ENSMUSG00000029672
AA Change: R69C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:ILEI 122 214 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164669
SMART Domains Protein: ENSMUSP00000132380
Gene: ENSMUSG00000029672

DomainStartEndE-ValueType
PDB:2YOP|C 1 152 2e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000165576
AA Change: R49C

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127709
Gene: ENSMUSG00000029672
AA Change: R49C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 224 4e-44 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000168965
AA Change: R49C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128135
Gene: ENSMUSG00000029672
AA Change: R49C

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 110 6e-10 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out or gene trap allele exhibit normal skeletal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Fam3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Fam3c APN 6 22318948 missense probably damaging 1.00
IGL01958:Fam3c APN 6 22318955 missense probably damaging 1.00
IGL02017:Fam3c APN 6 22343277 start codon destroyed probably null 0.66
PIT4812001:Fam3c UTSW 6 22321370 missense probably damaging 1.00
R1829:Fam3c UTSW 6 22309437 missense probably damaging 1.00
R2024:Fam3c UTSW 6 22329593 missense probably benign 0.33
R5481:Fam3c UTSW 6 22321358 missense probably benign 0.30
R5662:Fam3c UTSW 6 22355062 intron probably benign
R5911:Fam3c UTSW 6 22328561 missense probably damaging 1.00
R5911:Fam3c UTSW 6 22339300 missense probably benign 0.00
R6575:Fam3c UTSW 6 22329608 missense probably damaging 1.00
R6687:Fam3c UTSW 6 22328670 missense probably benign 0.03
R6982:Fam3c UTSW 6 22322301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGCAAACGCCCAGTG -3'
(R):5'- TTCTCCAGGATTTCAGCACAC -3'

Sequencing Primer
(F):5'- CCAGTGGGAATGAAGAGCCTATGAC -3'
(R):5'- GGATTTCAGCACACACTTGC -3'
Posted On2015-01-23