Incidental Mutation 'R2884:Nup93'
ID260967
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Namenucleoporin 93
Synonyms2410008G02Rik
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R2884 (G1)
Quality Score156
Status Not validated
Chromosome8
Chromosomal Location94214564-94317227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94303638 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 375 (Y375C)
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
Predicted Effect probably damaging
Transcript: ENSMUST00000079961
AA Change: Y375C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: Y375C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109547
AA Change: Y375C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: Y375C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211822
AA Change: Y252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212824
AA Change: Y375C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94309023 critical splice donor site probably null
IGL01652:Nup93 APN 8 94296559 missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94302109 nonsense probably null
IGL02169:Nup93 APN 8 94302129 missense probably damaging 1.00
IGL02212:Nup93 APN 8 94311662 critical splice donor site probably null
IGL02551:Nup93 APN 8 94227833 nonsense probably null
IGL02568:Nup93 APN 8 94309635 missense probably damaging 1.00
IGL03094:Nup93 APN 8 94296502 missense probably benign
IGL03248:Nup93 APN 8 94306088 missense probably damaging 0.98
IGL03273:Nup93 APN 8 94306277 missense probably benign 0.01
IGL03401:Nup93 APN 8 94309711 splice site probably null
PIT4585001:Nup93 UTSW 8 94243727 missense probably benign 0.25
R0409:Nup93 UTSW 8 94303665 missense probably damaging 1.00
R0748:Nup93 UTSW 8 94307943 missense probably damaging 1.00
R0891:Nup93 UTSW 8 94281263 splice site probably benign
R1667:Nup93 UTSW 8 94292687 missense possibly damaging 0.71
R1696:Nup93 UTSW 8 94296555 missense probably benign 0.29
R1862:Nup93 UTSW 8 94306102 missense probably damaging 1.00
R2069:Nup93 UTSW 8 94243739 missense probably damaging 1.00
R2143:Nup93 UTSW 8 94296480 nonsense probably null
R2187:Nup93 UTSW 8 94300850 missense probably damaging 1.00
R2228:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2229:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2254:Nup93 UTSW 8 94227857 critical splice donor site probably null
R4521:Nup93 UTSW 8 94314636 missense probably damaging 1.00
R4563:Nup93 UTSW 8 94307892 missense probably damaging 1.00
R4900:Nup93 UTSW 8 94286603 missense probably benign 0.25
R5570:Nup93 UTSW 8 94314670 missense probably damaging 1.00
R6226:Nup93 UTSW 8 94286537 missense probably damaging 1.00
R6489:Nup93 UTSW 8 94302088 missense probably benign 0.10
R6658:Nup93 UTSW 8 94304179 missense probably benign 0.02
R6817:Nup93 UTSW 8 94314682 critical splice donor site probably null
R6895:Nup93 UTSW 8 94243686 missense probably damaging 1.00
R6955:Nup93 UTSW 8 94309673 missense probably damaging 0.96
R7476:Nup93 UTSW 8 94303632 missense probably damaging 1.00
R7643:Nup93 UTSW 8 94286619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTAGCAATTAGAAGTCAGGTG -3'
(R):5'- ACTGTCCCTGTCCTGAGTAC -3'

Sequencing Primer
(F):5'- TAGCAATTAGAAGTCAGGTGAGAGTG -3'
(R):5'- ACTTCATGCATTACGAGCGTTGAG -3'
Posted On2015-01-23