Incidental Mutation 'R0331:Lztr1'
ID26097
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission 038540-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0331 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 17524237 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000100125] [ENSMUST00000115681] [ENSMUST00000142259] [ENSMUST00000231288] [ENSMUST00000231292] [ENSMUST00000231307] [ENSMUST00000231424] [ENSMUST00000231548] [ENSMUST00000231994] [ENSMUST00000232041] [ENSMUST00000232114] [ENSMUST00000232372]
Predicted Effect probably benign
Transcript: ENSMUST00000023444
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100125
SMART Domains Protein: ENSMUSP00000097701
Gene: ENSMUSG00000022760

DomainStartEndE-ValueType
THAP 3 99 5e-20 SMART
DM3 25 98 4.22e-20 SMART
low complexity region 118 130 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
coiled coil region 239 296 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142222
Predicted Effect
SMART Domains Protein: ENSMUSP00000118569
Gene: ENSMUSG00000022761

DomainStartEndE-ValueType
BTB 103 234 4.16e-4 SMART
BTB 327 460 1.7e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231230
Predicted Effect probably benign
Transcript: ENSMUST00000231288
Predicted Effect probably benign
Transcript: ENSMUST00000231292
Predicted Effect probably benign
Transcript: ENSMUST00000231307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231326
Predicted Effect probably benign
Transcript: ENSMUST00000231424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231446
Predicted Effect probably benign
Transcript: ENSMUST00000231548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231746
Predicted Effect probably benign
Transcript: ENSMUST00000231994
Predicted Effect probably benign
Transcript: ENSMUST00000232041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232046
Predicted Effect probably benign
Transcript: ENSMUST00000232114
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T A 8: 79,229,392 T79S probably benign Het
Abtb1 T C 6: 88,840,702 probably benign Het
Acot12 G A 13: 91,760,064 probably null Het
Adamts4 T A 1: 171,250,972 S54T probably benign Het
Adgrl4 T C 3: 151,497,940 S96P probably benign Het
Aip G T 19: 4,118,247 T40K probably damaging Het
Anapc4 A G 5: 52,855,642 probably benign Het
Asz1 A G 6: 18,103,619 probably benign Het
Atf7ip A G 6: 136,561,163 T465A possibly damaging Het
Atp11a C T 8: 12,816,953 Q127* probably null Het
Axin1 A G 17: 26,143,107 R142G probably damaging Het
B230359F08Rik A G 14: 53,795,748 N38S probably benign Het
Bcat1 T A 6: 145,047,314 E86V probably benign Het
Brd4 G A 17: 32,202,515 P749L probably benign Het
C1ra G A 6: 124,519,435 probably null Het
Capza2 A T 6: 17,665,103 N237I probably benign Het
Cd2ap A T 17: 42,805,301 V556E probably benign Het
Cfap65 G A 1: 74,929,301 P124L probably damaging Het
Cfap65 G T 1: 74,929,302 P124T probably damaging Het
Cftr T C 6: 18,235,226 V488A possibly damaging Het
Ckmt1 A T 2: 121,362,856 probably null Het
Cmya5 T G 13: 93,144,403 E35A possibly damaging Het
Col7a1 A G 9: 108,967,502 probably benign Het
Crmp1 C T 5: 37,265,313 L155F possibly damaging Het
Cyp2d10 T A 15: 82,407,026 T33S probably benign Het
Dhdh T C 7: 45,488,120 K48E probably benign Het
Dlst T C 12: 85,118,812 V103A probably damaging Het
Dohh C T 10: 81,387,812 T233I probably benign Het
Dvl2 C A 11: 70,006,217 probably benign Het
Eipr1 C T 12: 28,864,704 Q286* probably null Het
Enpp6 C A 8: 47,082,449 T343K probably damaging Het
Fbxw11 T A 11: 32,711,895 F112I probably damaging Het
Gdpd4 T A 7: 97,973,008 N231K probably benign Het
Gm6370 A T 5: 146,493,766 T254S probably benign Het
Hapln4 G T 8: 70,084,509 Q31H probably damaging Het
Hic1 T A 11: 75,165,490 T858S possibly damaging Het
Isg20l2 T C 3: 87,931,785 L101P probably damaging Het
Itga10 T C 3: 96,652,483 Y485H probably damaging Het
Itgal T A 7: 127,306,681 probably null Het
Itln1 T C 1: 171,531,549 N62S probably damaging Het
Kdm4b T C 17: 56,386,289 probably benign Het
Lct T C 1: 128,298,742 probably benign Het
Lman2 A T 13: 55,353,016 H123Q probably damaging Het
Myo3b G T 2: 70,095,261 G24V probably damaging Het
Nacad T A 11: 6,599,441 Q1250L possibly damaging Het
Ncor2 A T 5: 125,084,917 M431K unknown Het
Nek9 T A 12: 85,327,375 probably benign Het
Neu1 C A 17: 34,934,170 N255K possibly damaging Het
Nf2 T A 11: 4,794,914 T75S probably benign Het
Nipal4 T A 11: 46,150,213 D385V probably damaging Het
Olah T A 2: 3,342,474 N245I probably damaging Het
Olfr474 G T 7: 107,954,870 L76F probably benign Het
Pag1 T A 3: 9,701,970 T90S probably benign Het
Pald1 A G 10: 61,340,929 probably null Het
Parva A G 7: 112,544,798 M98V probably benign Het
Paxbp1 T A 16: 91,037,367 D177V possibly damaging Het
Paxip1 A G 5: 27,765,232 I587T probably damaging Het
Pclo T C 5: 14,680,376 probably benign Het
Pdgfra T A 5: 75,195,052 D1074E probably damaging Het
Pef1 A T 4: 130,127,448 D265V probably damaging Het
Plekhh2 G A 17: 84,586,366 E870K possibly damaging Het
Plscr4 G A 9: 92,482,642 G40D probably damaging Het
Psg18 A G 7: 18,353,308 Y142H probably benign Het
Ptchd3 A T 11: 121,842,191 M636L probably benign Het
Rab2a A G 4: 8,572,559 D51G probably benign Het
Rnf139 T A 15: 58,899,906 D593E probably benign Het
Sept7 A G 9: 25,306,256 N422S probably benign Het
Shprh T C 10: 11,194,170 probably benign Het
Slc7a6os A G 8: 106,210,567 I87T probably damaging Het
Slc7a7 A G 14: 54,377,924 probably benign Het
Spc24 G T 9: 21,757,313 N129K possibly damaging Het
Strip2 C T 6: 29,926,560 T148I probably benign Het
Tmem150c A C 5: 100,086,273 probably null Het
Ttn G T 2: 76,811,020 Y11801* probably null Het
Usp37 A T 1: 74,454,064 L688* probably null Het
Usp38 T C 8: 80,995,840 I351V probably benign Het
Vav2 T A 2: 27,296,175 M223L probably benign Het
Wdr36 A G 18: 32,852,915 I557M possibly damaging Het
Wwc2 A T 8: 47,880,204 M259K probably benign Het
Znfx1 G A 2: 167,046,978 S770L probably benign Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 unclassified probably null
IGL01512:Lztr1 APN 16 17522391 unclassified probably null
IGL01514:Lztr1 APN 16 17522391 unclassified probably null
IGL01516:Lztr1 APN 16 17522391 unclassified probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0717:Lztr1 UTSW 16 17516048 unclassified probably null
R1511:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3694:Lztr1 UTSW 16 17509061 missense possibly damaging 0.90
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R4645:Lztr1 UTSW 16 17524091 unclassified probably benign
R5624:Lztr1 UTSW 16 17512129 splice site probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17524132 missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGGAATGACTGGCACTTCTGGC -3'
(R):5'- TGTAGCGTAGCATGGACTCGAAGG -3'

Sequencing Primer
(F):5'- CACTTCTGGCTTTGGGAAAC -3'
(R):5'- GCCTGTCTGCTGGGAAC -3'
Posted On2013-04-16