Incidental Mutation 'R2884:Znrf3'
ID260974
Institutional Source Beutler Lab
Gene Symbol Znrf3
Ensembl Gene ENSMUSG00000041961
Gene Namezinc and ring finger 3
SynonymsLOC382477
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5276324-5444847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5289693 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 58 (D58E)
Ref Sequence ENSEMBL: ENSMUSP00000134698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109867] [ENSMUST00000143746] [ENSMUST00000172492]
Predicted Effect probably damaging
Transcript: ENSMUST00000109867
AA Change: D154E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105493
Gene: ENSMUSG00000041961
AA Change: D154E

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-103 PDB
transmembrane domain 218 235 N/A INTRINSIC
RING 290 330 1.56e-6 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143746
AA Change: D154E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122475
Gene: ENSMUSG00000041961
AA Change: D154E

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-111 PDB
low complexity region 209 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172492
AA Change: D58E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134698
Gene: ENSMUSG00000041961
AA Change: D58E

DomainStartEndE-ValueType
PDB:4CDK|D 2 109 5e-70 PDB
transmembrane domain 122 139 N/A INTRINSIC
RING 194 234 1.56e-6 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Meta Mutation Damage Score 0.3863 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit complete lethality around birth, aphakia, abnormal lens development and defective enural tube closure in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Other mutations in Znrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znrf3 APN 11 5289039 missense probably damaging 1.00
IGL01387:Znrf3 APN 11 5338656 nonsense probably null
IGL02895:Znrf3 APN 11 5289085 missense probably damaging 0.97
R0788:Znrf3 UTSW 11 5281320 missense probably benign 0.04
R1383:Znrf3 UTSW 11 5281994 missense probably damaging 0.96
R1544:Znrf3 UTSW 11 5289066 missense probably damaging 1.00
R1556:Znrf3 UTSW 11 5281347 missense probably benign 0.01
R1586:Znrf3 UTSW 11 5281477 missense probably damaging 1.00
R1852:Znrf3 UTSW 11 5287455 missense possibly damaging 0.94
R1864:Znrf3 UTSW 11 5283373 missense possibly damaging 0.95
R1927:Znrf3 UTSW 11 5281062 missense probably benign 0.28
R2353:Znrf3 UTSW 11 5281170 missense probably damaging 1.00
R2885:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R4021:Znrf3 UTSW 11 5281278 missense possibly damaging 0.68
R4811:Znrf3 UTSW 11 5287420 missense probably benign 0.07
R4935:Znrf3 UTSW 11 5283422 missense probably damaging 1.00
R5218:Znrf3 UTSW 11 5281519 missense possibly damaging 0.95
R5584:Znrf3 UTSW 11 5286218 missense probably damaging 1.00
R5698:Znrf3 UTSW 11 5289006 intron probably benign
R5715:Znrf3 UTSW 11 5286239 missense possibly damaging 0.91
R5900:Znrf3 UTSW 11 5282110 missense probably damaging 0.98
R5988:Znrf3 UTSW 11 5281776 missense probably damaging 1.00
R6253:Znrf3 UTSW 11 5280865 missense probably benign 0.14
R7057:Znrf3 UTSW 11 5282442 missense probably benign 0.00
R7062:Znrf3 UTSW 11 5281550 missense probably damaging 1.00
R7410:Znrf3 UTSW 11 5288955 missense unknown
Predicted Primers PCR Primer
(F):5'- ATATGCCTCTCTCAGGTATCATACC -3'
(R):5'- AGCCAGTGACTCATTCCCAC -3'

Sequencing Primer
(F):5'- TACCTGATACTCAAACACAGACAGAG -3'
(R):5'- ACAAAGTAGGTGGCATTGTCTCC -3'
Posted On2015-01-23