Incidental Mutation 'R2884:Exoc3l4'
ID260983
Institutional Source Beutler Lab
Gene Symbol Exoc3l4
Ensembl Gene ENSMUSG00000021280
Gene Nameexocyst complex component 3-like 4
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111417017-111431678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111428522 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 551 (D551G)
Ref Sequence ENSEMBL: ENSMUSP00000152337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072646] [ENSMUST00000220852] [ENSMUST00000222897] [ENSMUST00000223050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072646
AA Change: D551G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072438
Gene: ENSMUSG00000021280
AA Change: D551G

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Sec6 181 708 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181085
Predicted Effect probably benign
Transcript: ENSMUST00000220852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222262
Predicted Effect possibly damaging
Transcript: ENSMUST00000222897
AA Change: D551G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223050
AA Change: D551G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223369
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Exoc3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Exoc3l4 APN 12 111429411 splice site probably benign
IGL02048:Exoc3l4 APN 12 111428483 missense probably benign 0.00
IGL03049:Exoc3l4 APN 12 111423401 missense probably damaging 0.96
IGL03069:Exoc3l4 APN 12 111424023 missense probably damaging 1.00
IGL03123:Exoc3l4 APN 12 111422113 missense probably damaging 1.00
R0631:Exoc3l4 UTSW 12 111427966 missense probably benign 0.34
R1377:Exoc3l4 UTSW 12 111428670 missense probably damaging 1.00
R2223:Exoc3l4 UTSW 12 111426152 missense possibly damaging 0.73
R2402:Exoc3l4 UTSW 12 111422256 missense possibly damaging 0.94
R3770:Exoc3l4 UTSW 12 111425555 missense probably benign
R4843:Exoc3l4 UTSW 12 111428053 intron probably benign
R4903:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4964:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R4966:Exoc3l4 UTSW 12 111428721 missense probably benign 0.00
R5082:Exoc3l4 UTSW 12 111427990 missense probably benign 0.04
R5152:Exoc3l4 UTSW 12 111430893 utr 3 prime probably benign
R5210:Exoc3l4 UTSW 12 111428841 intron probably benign
R5667:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5671:Exoc3l4 UTSW 12 111423417 missense probably damaging 1.00
R5712:Exoc3l4 UTSW 12 111424042 nonsense probably null
R5873:Exoc3l4 UTSW 12 111423416 missense probably damaging 1.00
R5947:Exoc3l4 UTSW 12 111422401 missense possibly damaging 0.94
R6299:Exoc3l4 UTSW 12 111422079 start codon destroyed possibly damaging 0.59
R6332:Exoc3l4 UTSW 12 111427968 missense possibly damaging 0.79
R6489:Exoc3l4 UTSW 12 111428697 missense probably damaging 1.00
R7225:Exoc3l4 UTSW 12 111423624 missense probably benign 0.10
R7643:Exoc3l4 UTSW 12 111421935 intron probably benign
R7731:Exoc3l4 UTSW 12 111430748 missense possibly damaging 0.94
Z1088:Exoc3l4 UTSW 12 111429487 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGGCCTGACAAGACTCTTAGAC -3'
(R):5'- TATTCGCGGACCACAAAACG -3'

Sequencing Primer
(F):5'- TTTCCATACCCATTGGAGGAAGC -3'
(R):5'- AAACGGTGCACCTCCTG -3'
Posted On2015-01-23