Incidental Mutation 'R2884:Hexb'
ID260986
Institutional Source Beutler Lab
Gene Symbol Hexb
Ensembl Gene ENSMUSG00000021665
Gene Namehexosaminidase B
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97176331-97198357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97183700 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 272 (G272D)
Ref Sequence ENSEMBL: ENSMUSP00000022169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022169] [ENSMUST00000161825]
Predicted Effect probably damaging
Transcript: ENSMUST00000022169
AA Change: G272D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022169
Gene: ENSMUSG00000021665
AA Change: G272D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glycohydro_20b2 35 157 7.1e-24 PFAM
Pfam:Glyco_hydro_20 179 496 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222700
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants exhibit spasticity, muscle weakness, rigidity, tremors, and ataxia beginning around 4 months of age and resulting in death about 6 weeks later. Mutants accumulate GM2 ganglioside and glycolipid GA2 in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,145,511 E59D possibly damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Hexb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hexb APN 13 97181929 missense probably damaging 1.00
IGL02010:Hexb APN 13 97176845 missense probably benign 0.01
IGL02126:Hexb APN 13 97178024 missense possibly damaging 0.93
IGL02303:Hexb APN 13 97176893 missense probably damaging 1.00
IGL02955:Hexb APN 13 97181076 utr 3 prime probably benign
IGL02988:Hexb UTSW 13 97198221 missense unknown
R0311:Hexb UTSW 13 97183819 unclassified probably benign
R0470:Hexb UTSW 13 97177999 missense probably damaging 0.97
R0520:Hexb UTSW 13 97181110 missense probably benign 0.00
R0893:Hexb UTSW 13 97185627 missense probably benign 0.02
R1869:Hexb UTSW 13 97191259 missense probably benign
R2295:Hexb UTSW 13 97185612 missense probably damaging 1.00
R4237:Hexb UTSW 13 97176751 intron probably benign
R4238:Hexb UTSW 13 97176751 intron probably benign
R4239:Hexb UTSW 13 97176751 intron probably benign
R4689:Hexb UTSW 13 97181092 missense probably damaging 1.00
R5166:Hexb UTSW 13 97182004 missense probably benign 0.13
R6665:Hexb UTSW 13 97179385 missense probably benign 0.01
R7379:Hexb UTSW 13 97181164 missense probably damaging 1.00
R7553:Hexb UTSW 13 97198173 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGAATCTAGACAGTGATCG -3'
(R):5'- TTCTGAAACCGCGAATCATCC -3'

Sequencing Primer
(F):5'- TCGTGAAGGGACACAAAATACTTC -3'
(R):5'- GCGAATCATCCACTGTTTTATACTTG -3'
Posted On2015-01-23