Incidental Mutation 'R2885:Casp1'
ID 261011
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Name caspase 1
Synonyms ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2885 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 5298517-5307265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5299851 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 108 (H108L)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
AlphaFold P29452
Predicted Effect probably benign
Transcript: ENSMUST00000027015
AA Change: H108L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: H108L

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Mzt2 G T 16: 15,862,916 A3E unknown Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 splice site probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8002:Casp1 UTSW 9 5303164 missense possibly damaging 0.94
R8510:Casp1 UTSW 9 5303026 missense probably damaging 1.00
R8902:Casp1 UTSW 9 5299333 missense probably benign 0.41
R9234:Casp1 UTSW 9 5303128 missense probably benign 0.04
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTTAAAGACAACCACTCACC -3'
(R):5'- ACACAAGAACTGCCTTGCTC -3'

Sequencing Primer
(F):5'- CAGACTCCCATTTTTGTGTCTGTGG -3'
(R):5'- GAACTGCCTTGCTCAAACAAG -3'
Posted On 2015-01-23