Incidental Mutation 'R2885:Mzt2'
ID261029
Institutional Source Beutler Lab
Gene Symbol Mzt2
Ensembl Gene ENSMUSG00000022671
Gene Namemitotic spindle organizing protein 2
SynonymsFam128b, 2610001E06Rik, 2410018G20Rik
MMRRC Submission 040473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2885 (G1)
Quality Score111
Status Validated
Chromosome16
Chromosomal Location15848441-15863369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15862916 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 3 (A3E)
Ref Sequence ENSEMBL: ENSMUSP00000155739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023351] [ENSMUST00000117136] [ENSMUST00000229680]
Predicted Effect unknown
Transcript: ENSMUST00000023351
AA Change: A3E
SMART Domains Protein: ENSMUSP00000023351
Gene: ENSMUSG00000022671
AA Change: A3E

DomainStartEndE-ValueType
Pfam:MOZART2 1 99 1.4e-38 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117136
AA Change: A3E
SMART Domains Protein: ENSMUSP00000113832
Gene: ENSMUSG00000022671
AA Change: A3E

DomainStartEndE-ValueType
Pfam:MOZART2 11 98 4.5e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137864
Predicted Effect unknown
Transcript: ENSMUST00000229680
AA Change: A3E
Meta Mutation Damage Score 0.0887 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 A G 7: 81,100,192 S1453G probably damaging Het
Arhgap27 T C 11: 103,360,843 probably null Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cerk A G 15: 86,142,883 F142S probably damaging Het
Cmip A G 8: 117,384,965 N145S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp4b1 C T 4: 115,635,652 D287N probably damaging Het
Dlx2 G A 2: 71,545,464 R172* probably null Het
Dnah11 G A 12: 117,987,427 Q1145* probably null Het
Dock2 A T 11: 34,689,766 I659N probably damaging Het
Dync2h1 G C 9: 7,102,329 F2690L probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Ift57 T C 16: 49,763,751 V289A probably damaging Het
Lrrc46 G A 11: 97,034,980 R219C probably damaging Het
Mapk1 A G 16: 17,026,445 N269S probably benign Het
Mrgprb1 A T 7: 48,447,721 Y148N probably damaging Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Obscn A T 11: 59,086,748 V1959E probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Phf12 T C 11: 78,023,769 I130T possibly damaging Het
Plekhg3 T C 12: 76,564,961 V338A probably benign Het
Prl3b1 A T 13: 27,249,522 N220I probably damaging Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Setdb1 A G 3: 95,340,195 I463T probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Siglec1 A G 2: 131,072,747 F1483S possibly damaging Het
Sis G A 3: 72,909,173 P1515S probably benign Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Ttc39d A G 17: 80,216,715 S268G probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r60 T A 7: 42,140,979 D463E possibly damaging Het
Vmn2r91 A T 17: 18,105,366 Y82F probably benign Het
Zfp709 A T 8: 71,889,705 D325V probably benign Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in Mzt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mzt2 APN 16 15862410 missense possibly damaging 0.57
IGL01688:Mzt2 APN 16 15862929 start gained probably benign
R1962:Mzt2 UTSW 16 15848679 missense probably damaging 0.99
R6192:Mzt2 UTSW 16 15848687 missense probably benign 0.12
R7560:Mzt2 UTSW 16 15862805 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTATGAGCTCAAAGTCCCG -3'
(R):5'- ATCGTCAGGCAGTGATCAGC -3'

Sequencing Primer
(F):5'- GAGCTCAAAGTCCCGACCCC -3'
(R):5'- TCAGGCAGTGATCAGCTTCCC -3'
Posted On2015-01-23