Incidental Mutation 'R2886:Selenon'
ID261044
Institutional Source Beutler Lab
Gene Symbol Selenon
Ensembl Gene ENSMUSG00000050989
Gene Nameselenoprotein N
SynonymsSepn1, 1110019I12Rik
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134537892-134552166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134543069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 324 (D324G)
Ref Sequence ENSEMBL: ENSMUSP00000060026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060435]
Predicted Effect probably null
Transcript: ENSMUST00000060435
AA Change: D324G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060026
Gene: ENSMUSG00000050989
AA Change: D324G

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1k94a_ 76 113 4e-3 SMART
low complexity region 160 179 N/A INTRINSIC
low complexity region 526 532 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127585
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in the orthologous gene in human are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. Knockout mice deleted for this gene exhibit abnormal lung development. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit satellite cell loss and impaired muscle regeneration. Mice homozygous for a different knock-out allele exhibit subtle core lesions in skeletal muscle after induced oxidative stress and abnormal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Selenon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Selenon APN 4 134539726 unclassified probably benign
IGL02832:Selenon APN 4 134540908 missense probably damaging 1.00
IGL03015:Selenon APN 4 134545518 missense probably benign 0.43
I0000:Selenon UTSW 4 134542701 splice site probably benign
R1400:Selenon UTSW 4 134551518 missense probably benign 0.00
R1436:Selenon UTSW 4 134540686 missense probably damaging 1.00
R1932:Selenon UTSW 4 134544618 missense probably damaging 0.99
R3884:Selenon UTSW 4 134539770 missense possibly damaging 0.80
R4647:Selenon UTSW 4 134545657 missense probably damaging 1.00
R4721:Selenon UTSW 4 134543076 nonsense probably null
R5091:Selenon UTSW 4 134547973 missense probably damaging 1.00
R5412:Selenon UTSW 4 134542438 missense probably benign 0.00
R5553:Selenon UTSW 4 134540917 missense probably damaging 1.00
R7048:Selenon UTSW 4 134542843 missense probably benign 0.04
R7222:Selenon UTSW 4 134547977 missense possibly damaging 0.60
R7470:Selenon UTSW 4 134539750 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTCATCTAGGATCACAGAGGGC -3'
(R):5'- TGAGAGCCCTGTGCACTATC -3'

Sequencing Primer
(F):5'- CACCGAGGGGCCCACAG -3'
(R):5'- TGTGCACTATCCAGGCCTG -3'
Posted On2015-01-23