Incidental Mutation 'R2886:Serpinh1'
ID261051
Institutional Source Beutler Lab
Gene Symbol Serpinh1
Ensembl Gene ENSMUSG00000070436
Gene Nameserine (or cysteine) peptidase inhibitor, clade H, member 1
SynonymsHsp47, gp46, Cbp2, Serpinh2, Cbp1, colligin, J6
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99345376-99353239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99349021 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 134 (Y134C)
Ref Sequence ENSEMBL: ENSMUSP00000146515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094154] [ENSMUST00000169437] [ENSMUST00000207849] [ENSMUST00000207989] [ENSMUST00000208119] [ENSMUST00000208292] [ENSMUST00000208749]
Predicted Effect probably damaging
Transcript: ENSMUST00000094154
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091706
Gene: ENSMUSG00000070436
AA Change: Y134C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169437
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126390
Gene: ENSMUSG00000070436
AA Change: Y134C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207849
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207989
Predicted Effect probably damaging
Transcript: ENSMUST00000208119
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208292
Predicted Effect probably damaging
Transcript: ENSMUST00000208749
AA Change: Y134C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. Mice homozygous for a conditional allele activated in chondrocytes exhibit complete perinatal lethality, cleft palate, respiratory distress, abnormal chondocytes and bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Serpinh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02405:Serpinh1 APN 7 99347334 missense possibly damaging 0.94
IGL02506:Serpinh1 APN 7 99346992 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0608:Serpinh1 UTSW 7 99349394 missense unknown
R1338:Serpinh1 UTSW 7 99348911 missense probably damaging 1.00
R1612:Serpinh1 UTSW 7 99348931 missense probably damaging 0.97
R1916:Serpinh1 UTSW 7 99349081 missense probably damaging 1.00
R2321:Serpinh1 UTSW 7 99346385 missense probably damaging 1.00
R4176:Serpinh1 UTSW 7 99346999 missense probably benign
R5860:Serpinh1 UTSW 7 99346364 missense probably damaging 1.00
R7345:Serpinh1 UTSW 7 99346356 missense probably damaging 0.99
R7884:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
R7967:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
R8215:Serpinh1 UTSW 7 99346338 missense possibly damaging 0.58
R8309:Serpinh1 UTSW 7 99348944 missense possibly damaging 0.94
RF005:Serpinh1 UTSW 7 99346203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCACGCTTAAAGAACATGGC -3'
(R):5'- ATCCCTGGGTCTTGTGTCACTG -3'

Sequencing Primer
(F):5'- CATGGCGTTCACAAGCAG -3'
(R):5'- TGTCACTGGGTGGTAAAGC -3'
Posted On2015-01-23