Incidental Mutation 'R2886:Slc5a4b'
ID261057
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R2886 (G1)
Quality Score185
Status Validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76075073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 310 (V310M)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: V310M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: V310M

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124320
Meta Mutation Damage Score 0.3289 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 76103846 missense possibly damaging 0.93
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTGGTGGGTCTGAAGACAG -3'
(R):5'- AGCCCACTGGTTTCCACTAG -3'

Sequencing Primer
(F):5'- TCTGAAGACAGTGACAGTGTACTC -3'
(R):5'- CCCTGTGTCCATGGAGATCAAAAG -3'
Posted On2015-01-23