Incidental Mutation 'R2886:Smc6'
ID261063
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11276293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 97 (V97A)
Ref Sequence ENSEMBL: ENSMUSP00000151976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000217906] [ENSMUST00000218022] [ENSMUST00000218866] [ENSMUST00000219776]
Predicted Effect probably damaging
Transcript: ENSMUST00000020931
AA Change: V97A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608
AA Change: V97A

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217906
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect probably damaging
Transcript: ENSMUST00000218866
AA Change: V97A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219776
Meta Mutation Damage Score 0.5777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Cables1 A G 18: 11,939,732 D448G possibly damaging Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0365:Smc6 UTSW 12 11283174 critical splice donor site probably null
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
R7477:Smc6 UTSW 12 11271807 missense probably benign
R7698:Smc6 UTSW 12 11283140 missense possibly damaging 0.92
R7832:Smc6 UTSW 12 11317843 missense probably benign 0.28
R7863:Smc6 UTSW 12 11289129 missense probably benign 0.00
R7915:Smc6 UTSW 12 11317843 missense probably benign 0.28
R7946:Smc6 UTSW 12 11289129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGCCACTTTACCACTGG -3'
(R):5'- GAAAGCATGCTTCTTACTAGAGAAC -3'

Sequencing Primer
(F):5'- CAGCACTTTCTGTCTCTGA -3'
(R):5'- GCATCTACCCTTCACATGAGGG -3'
Posted On2015-01-23