Mutagenetix > Incidental Mutation

Incidental Mutation 'R2886:Zfpm2'

261067

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

040474-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2886 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41102323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 603 (T603A)

Ref Sequence

ENSEMBL: ENSMUSP00000155094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably benign
Transcript: ENSMUST00000053467
AA Change: T735A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: T735A

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230319
AA Change: T603A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,144,886		probably benign	Het
Bicdl2	G	A	17: 23,666,758		probably null	Het
Cables1	A	G	18: 11,939,732	D448G	possibly damaging	Het
Casq2	A	T	3: 102,144,218	N338I	probably damaging	Het
Ccr1l1	T	C	9: 123,977,516	N298S	probably damaging	Het
Dnajc17	A	G	2: 119,179,452	V231A	probably benign	Het
Ell2	T	C	13: 75,763,785	S397P	probably damaging	Het
Gm5434	A	G	12: 36,090,575		probably benign	Het
Gm9966	T	C	7: 95,958,546	C25R	unknown	Het
H2-DMa	A	G	17: 34,137,147	N41S	probably damaging	Het
Helz2	A	G	2: 181,240,742	M86T	probably benign	Het
Il17rd	T	A	14: 27,099,553	I268N	probably damaging	Het
Ipcef1	C	T	10: 6,900,641	V317M	probably damaging	Het
Itgae	A	T	11: 73,140,687	E1076D	probably benign	Het
Kcnq5	A	T	1: 21,469,547	Y382*	probably null	Het
Kif21b	G	A	1: 136,147,874		probably benign	Het
Lilrb4a	A	T	10: 51,491,613	N84Y	probably benign	Het
Mdga2	A	G	12: 66,506,270		probably benign	Het
Naca	T	C	10: 128,041,678		probably benign	Het
Naif1	C	T	2: 32,454,875	P197L	probably benign	Het
Nrk	T	C	X: 138,975,448	L466P	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Pkn1	G	A	8: 83,681,238	A421V	probably benign	Het
Rusc2	A	G	4: 43,415,456	Q254R	probably benign	Het
Ryr1	G	T	7: 29,074,798	R2404S	probably damaging	Het
Selenon	T	C	4: 134,543,069	D324G	probably null	Het
Serpinh1	T	C	7: 99,349,021	Y134C	probably damaging	Het
Serpini2	T	C	3: 75,259,614	Y112C	probably damaging	Het
Setx	T	G	2: 29,148,625	C1707W	probably damaging	Het
Sit1	C	T	4: 43,483,314	R50H	possibly damaging	Het
Slc27a5	T	A	7: 12,989,560		probably benign	Het
Slc5a4b	C	T	10: 76,075,073	V310M	probably damaging	Het
Smc6	T	C	12: 11,276,293	V97A	probably damaging	Het
Usp42	T	C	5: 143,721,629		probably benign	Het
Utrn	A	T	10: 12,739,361		probably null	Het
Vmn2r82	A	G	10: 79,396,248	I694V	probably benign	Het
Vmn2r-ps69	T	C	7: 85,307,624		noncoding transcript	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AAATCCCAGCGGTCCCTTAG -3'
(R):5'- GGCCAATGATGTTTCCAAGTG -3'

Sequencing Primer
(F):5'- CAGCGGTCCCTTAGTGGATG -3'
(R):5'- CCAAGTGCTTAGAGACAATTCCTGG -3'

Posted On

2015-01-23