Incidental Mutation 'R2886:Zfpm2'
ID 261067
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 040474-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2886 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40965719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 603 (T603A)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: T735A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: T735A

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230319
AA Change: T603A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,035,712 (GRCm39) probably benign Het
Bicdl2 G A 17: 23,885,732 (GRCm39) probably null Het
Cables1 A G 18: 12,072,789 (GRCm39) D448G possibly damaging Het
Casq2 A T 3: 102,051,534 (GRCm39) N338I probably damaging Het
Ccr1l1 T C 9: 123,777,553 (GRCm39) N298S probably damaging Het
Dnajc17 A G 2: 119,009,933 (GRCm39) V231A probably benign Het
Ell2 T C 13: 75,911,904 (GRCm39) S397P probably damaging Het
Gm9966 T C 7: 95,607,753 (GRCm39) C25R unknown Het
H2-DMa A G 17: 34,356,121 (GRCm39) N41S probably damaging Het
Helz2 A G 2: 180,882,535 (GRCm39) M86T probably benign Het
Il17rd T A 14: 26,821,510 (GRCm39) I268N probably damaging Het
Ipcef1 C T 10: 6,850,641 (GRCm39) V317M probably damaging Het
Itgae A T 11: 73,031,513 (GRCm39) E1076D probably benign Het
Kcnq5 A T 1: 21,539,771 (GRCm39) Y382* probably null Het
Kif21b G A 1: 136,075,612 (GRCm39) probably benign Het
Lilrb4a A T 10: 51,367,709 (GRCm39) N84Y probably benign Het
Mdga2 A G 12: 66,553,044 (GRCm39) probably benign Het
Naca T C 10: 127,877,547 (GRCm39) probably benign Het
Naif1 C T 2: 32,344,887 (GRCm39) P197L probably benign Het
Nrk T C X: 137,876,197 (GRCm39) L466P probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Pkn1 G A 8: 84,407,867 (GRCm39) A421V probably benign Het
Rusc2 A G 4: 43,415,456 (GRCm39) Q254R probably benign Het
Ryr1 G T 7: 28,774,223 (GRCm39) R2404S probably damaging Het
Selenon T C 4: 134,270,380 (GRCm39) D324G probably null Het
Serpinh1 T C 7: 98,998,228 (GRCm39) Y134C probably damaging Het
Serpini2 T C 3: 75,166,921 (GRCm39) Y112C probably damaging Het
Setx T G 2: 29,038,637 (GRCm39) C1707W probably damaging Het
Sit1 C T 4: 43,483,314 (GRCm39) R50H possibly damaging Het
Slc27a5 T A 7: 12,723,487 (GRCm39) probably benign Het
Slc5a4b C T 10: 75,910,907 (GRCm39) V310M probably damaging Het
Smc6 T C 12: 11,326,294 (GRCm39) V97A probably damaging Het
Ube2frt A G 12: 36,140,574 (GRCm39) probably benign Het
Usp42 T C 5: 143,707,384 (GRCm39) probably benign Het
Utrn A T 10: 12,615,105 (GRCm39) probably null Het
Vmn2r82 A G 10: 79,232,082 (GRCm39) I694V probably benign Het
Vmn2r-ps69 T C 7: 84,956,832 (GRCm39) noncoding transcript Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 40,966,940 (GRCm39) missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 40,966,386 (GRCm39) missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R7893:Zfpm2 UTSW 15 40,966,008 (GRCm39) missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40,616,355 (GRCm39) missense probably benign 0.34
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAATCCCAGCGGTCCCTTAG -3'
(R):5'- GGCCAATGATGTTTCCAAGTG -3'

Sequencing Primer
(F):5'- CAGCGGTCCCTTAGTGGATG -3'
(R):5'- CCAAGTGCTTAGAGACAATTCCTGG -3'
Posted On 2015-01-23