Incidental Mutation 'R2886:Cables1'
ID261069
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene NameCDK5 and Abl enzyme substrate 1
Synonymsik3-1, interactor-1 with cdk3
MMRRC Submission 040474-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R2886 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location11839220-11945630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11939732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 448 (D448G)
Ref Sequence ENSEMBL: ENSMUSP00000129463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
Predicted Effect probably benign
Transcript: ENSMUST00000046948
AA Change: D422G

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: D422G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171109
AA Change: D448G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: D448G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225430
Meta Mutation Damage Score 0.3510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,144,886 probably benign Het
Bicdl2 G A 17: 23,666,758 probably null Het
Casq2 A T 3: 102,144,218 N338I probably damaging Het
Ccr1l1 T C 9: 123,977,516 N298S probably damaging Het
Dnajc17 A G 2: 119,179,452 V231A probably benign Het
Ell2 T C 13: 75,763,785 S397P probably damaging Het
Gm5434 A G 12: 36,090,575 probably benign Het
Gm9966 T C 7: 95,958,546 C25R unknown Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Helz2 A G 2: 181,240,742 M86T probably benign Het
Il17rd T A 14: 27,099,553 I268N probably damaging Het
Ipcef1 C T 10: 6,900,641 V317M probably damaging Het
Itgae A T 11: 73,140,687 E1076D probably benign Het
Kcnq5 A T 1: 21,469,547 Y382* probably null Het
Kif21b G A 1: 136,147,874 probably benign Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mdga2 A G 12: 66,506,270 probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nrk T C X: 138,975,448 L466P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pkn1 G A 8: 83,681,238 A421V probably benign Het
Rusc2 A G 4: 43,415,456 Q254R probably benign Het
Ryr1 G T 7: 29,074,798 R2404S probably damaging Het
Selenon T C 4: 134,543,069 D324G probably null Het
Serpinh1 T C 7: 99,349,021 Y134C probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Sit1 C T 4: 43,483,314 R50H possibly damaging Het
Slc27a5 T A 7: 12,989,560 probably benign Het
Slc5a4b C T 10: 76,075,073 V310M probably damaging Het
Smc6 T C 12: 11,276,293 V97A probably damaging Het
Usp42 T C 5: 143,721,629 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r-ps69 T C 7: 85,307,624 noncoding transcript Het
Zfpm2 A G 15: 41,102,323 T603A probably benign Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 11944564 missense probably damaging 0.99
IGL01373:Cables1 APN 18 11888764 missense probably damaging 0.98
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11840523 nonsense probably null
R4845:Cables1 UTSW 18 11944488 missense probably damaging 0.99
R4964:Cables1 UTSW 18 11941277 missense possibly damaging 0.92
R5286:Cables1 UTSW 18 11924827 missense probably benign 0.11
R5756:Cables1 UTSW 18 11941353 missense probably damaging 1.00
R6755:Cables1 UTSW 18 11939825 missense probably null 1.00
R7162:Cables1 UTSW 18 11926366 critical splice donor site probably null
R7242:Cables1 UTSW 18 11840007 missense possibly damaging 0.93
R7410:Cables1 UTSW 18 11941225 missense probably benign
R7411:Cables1 UTSW 18 11840515 missense probably benign 0.01
R7965:Cables1 UTSW 18 11840212 missense probably benign 0.06
Z1177:Cables1 UTSW 18 11941317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCCAAGCTCCTGAGTG -3'
(R):5'- ACTACAATACGCTGTATGAGCTCAG -3'

Sequencing Primer
(F):5'- AGTGGGCTGACATGGATTTAAATC -3'
(R):5'- AGCTCAGTGTGTGCTGGAAG -3'
Posted On2015-01-23