Incidental Mutation 'R2908:Clp1'
ID 261098
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene Name CLP1, cleavage and polyadenylation factor I subunit
Synonyms
MMRRC Submission 040495-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2908 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 84553466-84557631 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84554488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000129300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
AlphaFold Q99LI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000028475
AA Change: V227A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: V227A

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138231
Predicted Effect possibly damaging
Transcript: ENSMUST00000165219
AA Change: V227A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: V227A

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,149,237 (GRCm39) probably null Het
Ap1b1 T A 11: 4,981,641 (GRCm39) N516K probably damaging Het
Atp1a4 A G 1: 172,062,044 (GRCm39) Y694H probably benign Het
Bhlha9 T C 11: 76,563,433 (GRCm39) V20A probably benign Het
Ccl28 C A 13: 120,112,398 (GRCm39) probably null Het
Cdk14 T C 5: 5,299,051 (GRCm39) I55V probably benign Het
Cit C A 5: 116,119,735 (GRCm39) D1246E probably benign Het
Dhx29 T C 13: 113,064,385 (GRCm39) V20A possibly damaging Het
Lima1 C T 15: 99,699,991 (GRCm39) probably null Het
Lyst A G 13: 13,844,458 (GRCm39) I1883V probably benign Het
Myh1 C T 11: 67,111,522 (GRCm39) Q1654* probably null Het
Or5d46 T C 2: 88,170,827 (GRCm39) I306T probably benign Het
Pbx3 G T 2: 34,062,933 (GRCm39) T422K probably damaging Het
Plekhg4 T C 8: 106,107,493 (GRCm39) L1008P probably damaging Het
Rbm26 T A 14: 105,380,270 (GRCm39) T516S probably benign Het
Slc25a40 C T 5: 8,477,505 (GRCm39) T30I probably damaging Het
Spata31d1c A T 13: 65,181,005 (GRCm39) I35F possibly damaging Het
Tmem18 A T 12: 30,637,252 (GRCm39) R78* probably null Het
Uggt2 C T 14: 119,256,919 (GRCm39) S1105N probably benign Het
Zfp53 C A 17: 21,728,736 (GRCm39) C256* probably null Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84,554,208 (GRCm39) missense probably benign 0.36
D4186:Clp1 UTSW 2 84,555,979 (GRCm39) missense probably benign 0.00
R0540:Clp1 UTSW 2 84,555,935 (GRCm39) missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84,555,935 (GRCm39) missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84,554,395 (GRCm39) missense probably damaging 1.00
R4769:Clp1 UTSW 2 84,556,219 (GRCm39) missense possibly damaging 0.53
R4949:Clp1 UTSW 2 84,554,086 (GRCm39) missense possibly damaging 0.58
R5568:Clp1 UTSW 2 84,556,322 (GRCm39) nonsense probably null
R7191:Clp1 UTSW 2 84,554,490 (GRCm39) nonsense probably null
R8341:Clp1 UTSW 2 84,554,117 (GRCm39) missense probably damaging 0.98
R9055:Clp1 UTSW 2 84,554,266 (GRCm39) missense probably damaging 1.00
R9220:Clp1 UTSW 2 84,554,076 (GRCm39) missense probably damaging 1.00
R9351:Clp1 UTSW 2 84,554,195 (GRCm39) missense probably benign 0.01
R9366:Clp1 UTSW 2 84,556,473 (GRCm39) missense probably benign
R9768:Clp1 UTSW 2 84,556,477 (GRCm39) start codon destroyed probably null 0.86
Z1177:Clp1 UTSW 2 84,556,307 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCTGATTTTGGAAGCAAC -3'
(R):5'- TCCAGCCTGTAAAGCTTTTGG -3'

Sequencing Primer
(F):5'- TTTGGAAGCAACACAGTTCG -3'
(R):5'- TGTAACTCAAGCTCCAGGGGTATC -3'
Posted On 2015-01-23