Incidental Mutation 'R2908:Clp1'
ID261098
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene NameCLP1, cleavage and polyadenylation factor I subunit
Synonyms
MMRRC Submission 040495-MU
Accession Numbers

Genbank: NM_133840; MGI: 2138968

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84722104-84727350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84724144 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000129300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028475
AA Change: V227A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: V227A

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138231
Predicted Effect possibly damaging
Transcript: ENSMUST00000165219
AA Change: V227A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: V227A

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Tmem18 A T 12: 30,587,253 R78* probably null Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84723864 missense probably benign 0.36
D4186:Clp1 UTSW 2 84725635 missense probably benign 0.00
R0540:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84724051 missense probably damaging 1.00
R4769:Clp1 UTSW 2 84725875 missense possibly damaging 0.53
R4949:Clp1 UTSW 2 84723742 missense possibly damaging 0.58
R5568:Clp1 UTSW 2 84725978 nonsense probably null
R7191:Clp1 UTSW 2 84724146 nonsense probably null
Z1177:Clp1 UTSW 2 84725963 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCTGATTTTGGAAGCAAC -3'
(R):5'- TCCAGCCTGTAAAGCTTTTGG -3'

Sequencing Primer
(F):5'- TTTGGAAGCAACACAGTTCG -3'
(R):5'- TGTAACTCAAGCTCCAGGGGTATC -3'
Posted On2015-01-23