Incidental Mutation 'R2909:Chrm3'
ID 261149
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, Chrm-3, M3R
MMRRC Submission 040496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R2909 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 9875486-10360847 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 9877997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 334 (D334E)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect probably benign
Transcript: ENSMUST00000063093
AA Change: D334E

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: D334E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187510
AA Change: D334E

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: D334E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,947,953 D1349G probably damaging Het
Actr5 G A 2: 158,625,220 G27R possibly damaging Het
AF529169 T C 9: 89,591,278 N860S probably damaging Het
Clic5 A C 17: 44,275,259 T212P probably benign Het
Dapk1 G A 13: 60,716,817 probably null Het
Dync2h1 A T 9: 7,049,114 L3262H probably damaging Het
Epg5 G C 18: 77,983,476 W1227C probably damaging Het
Fancm T C 12: 65,124,856 S1757P probably damaging Het
Gm3604 G C 13: 62,369,018 H509D probably benign Het
Gramd4 G T 15: 86,122,183 E163* probably null Het
Hip1r T A 5: 124,000,593 probably null Het
Ice1 G T 13: 70,596,173 T2097K probably damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kbtbd7 A G 14: 79,428,482 T585A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 T C 15: 66,025,236 T272A possibly damaging Het
Ly6l T G 15: 75,449,632 probably null Het
Mrps11 C A 7: 78,788,749 A83E probably damaging Het
Olfr366 C T 2: 37,220,176 P229L probably damaging Het
Pax7 T C 4: 139,828,696 I156V possibly damaging Het
Plbd1 A T 6: 136,634,574 V235D probably damaging Het
Pml T C 9: 58,247,243 S76G possibly damaging Het
Ppp1r42 T A 1: 10,003,412 probably benign Het
Rsl24d1 T C 9: 73,122,303 L61S probably damaging Het
Rtp2 T C 16: 23,927,485 E132G probably damaging Het
Sgk1 A G 10: 21,994,816 I23V probably benign Het
Sharpin A G 15: 76,350,611 probably benign Het
Sipa1l1 T A 12: 82,357,331 Y533N probably benign Het
Slc12a9 T C 5: 137,332,201 I81V probably benign Het
Stxbp5l G A 16: 37,208,186 T505M possibly damaging Het
Tmem40 A G 6: 115,736,381 probably null Het
Tnfrsf18 A T 4: 156,028,270 N138Y probably damaging Het
Vmn2r87 A T 10: 130,478,996 N240K probably damaging Het
Vmn2r91 A G 17: 18,136,399 E776G probably damaging Het
Vmn2r92 T A 17: 18,185,115 N840K possibly damaging Het
Vmn2r98 T C 17: 19,067,402 I499T probably damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9878598 missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9877278 missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9878464 nonsense probably null
IGL03085:Chrm3 APN 13 9877534 missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9878184 missense probably benign 0.22
R0147:Chrm3 UTSW 13 9878744 missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9877933 missense probably benign 0.10
R0544:Chrm3 UTSW 13 9877579 missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9878314 missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9878425 missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9878758 missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9877416 missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9878481 missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9878335 missense probably damaging 1.00
R4212:Chrm3 UTSW 13 9877755 missense probably benign 0.01
R4422:Chrm3 UTSW 13 9878555 nonsense probably null
R4790:Chrm3 UTSW 13 9877662 missense probably benign 0.10
R4934:Chrm3 UTSW 13 9877414 missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9878557 missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9877387 missense possibly damaging 0.92
R6154:Chrm3 UTSW 13 9878440 missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9877662 missense probably benign
R6693:Chrm3 UTSW 13 9877422 missense probably benign 0.27
R7135:Chrm3 UTSW 13 9877801 missense probably benign 0.00
R7297:Chrm3 UTSW 13 9877833 missense probably benign 0.01
R7423:Chrm3 UTSW 13 9878809 missense probably benign
R7591:Chrm3 UTSW 13 9877313 nonsense probably null
R8353:Chrm3 UTSW 13 9877231 makesense probably null
R8355:Chrm3 UTSW 13 9878610 missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9878302 missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9877231 makesense probably null
R9227:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9230:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9336:Chrm3 UTSW 13 9878616 missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9877401 missense
R9537:Chrm3 UTSW 13 9877426 missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9877444 missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9877720 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTTCTGGGCCTGAAGCTTATG -3'
(R):5'- AACTTTGTCCACCCCACAGG -3'

Sequencing Primer
(F):5'- CCTGAAGCTTATGGGCATTTC -3'
(R):5'- CAGGCAGTTCTCGAAGCTGTAG -3'
Posted On 2015-01-23