Incidental Mutation 'R2909:Ice1'
ID 261152
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 040496-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R2909 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70744292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 2097 (T2097K)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: T2097K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: T2097K

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect unknown
Transcript: ENSMUST00000222274
AA Change: T24K
Predicted Effect unknown
Transcript: ENSMUST00000223102
AA Change: T27K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 G A 2: 158,467,140 (GRCm39) G27R possibly damaging Het
Bltp1 A G 3: 37,002,102 (GRCm39) D1349G probably damaging Het
Chrm3 G T 13: 9,928,033 (GRCm39) D334E probably benign Het
Clic5 A C 17: 44,586,146 (GRCm39) T212P probably benign Het
Dapk1 G A 13: 60,864,631 (GRCm39) probably null Het
Dync2h1 A T 9: 7,049,114 (GRCm39) L3262H probably damaging Het
Epg5 G C 18: 78,026,691 (GRCm39) W1227C probably damaging Het
Fancm T C 12: 65,171,630 (GRCm39) S1757P probably damaging Het
Gm3604 G C 13: 62,516,832 (GRCm39) H509D probably benign Het
Gramd4 G T 15: 86,006,384 (GRCm39) E163* probably null Het
Hip1r T A 5: 124,138,656 (GRCm39) probably null Het
Il12a TCAC TC 3: 68,605,320 (GRCm39) probably null Het
Kbtbd7 A G 14: 79,665,922 (GRCm39) T585A probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kcnq3 T C 15: 65,897,085 (GRCm39) T272A possibly damaging Het
Ly6l T G 15: 75,321,481 (GRCm39) probably null Het
Minar1 T C 9: 89,473,331 (GRCm39) N860S probably damaging Het
Mrps11 C A 7: 78,438,497 (GRCm39) A83E probably damaging Het
Or1af1 C T 2: 37,110,188 (GRCm39) P229L probably damaging Het
Pax7 T C 4: 139,556,007 (GRCm39) I156V possibly damaging Het
Plbd1 A T 6: 136,611,572 (GRCm39) V235D probably damaging Het
Pml T C 9: 58,154,526 (GRCm39) S76G possibly damaging Het
Ppp1r42 T A 1: 10,073,637 (GRCm39) probably benign Het
Rsl24d1 T C 9: 73,029,585 (GRCm39) L61S probably damaging Het
Rtp2 T C 16: 23,746,235 (GRCm39) E132G probably damaging Het
Sgk1 A G 10: 21,870,715 (GRCm39) I23V probably benign Het
Sharpin A G 15: 76,234,811 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,404,105 (GRCm39) Y533N probably benign Het
Slc12a9 T C 5: 137,330,463 (GRCm39) I81V probably benign Het
Stxbp5l G A 16: 37,028,548 (GRCm39) T505M possibly damaging Het
Tmem40 A G 6: 115,713,342 (GRCm39) probably null Het
Tnfrsf18 A T 4: 156,112,727 (GRCm39) N138Y probably damaging Het
Vmn2r87 A T 10: 130,314,865 (GRCm39) N240K probably damaging Het
Vmn2r91 A G 17: 18,356,661 (GRCm39) E776G probably damaging Het
Vmn2r92 T A 17: 18,405,377 (GRCm39) N840K possibly damaging Het
Vmn2r98 T C 17: 19,287,664 (GRCm39) I499T probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTTGGACATTTTCAGGCTAC -3'
(R):5'- GCATAGCGTAAATGGCAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGACATTTTCAGGCTACTTTTG -3'
(R):5'- CTGTGCCCGAAAACAGA -3'
Posted On 2015-01-23