Mutagenetix > Incidental Mutation

Incidental Mutation 'R2909:Vmn2r98'

261163

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

040496-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R2909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19067402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 499 (I499T)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

probably damaging
Transcript: ENSMUST00000170424
AA Change: I499T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: I499T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,947,953	D1349G	probably damaging	Het
Actr5	G	A	2: 158,625,220	G27R	possibly damaging	Het
AF529169	T	C	9: 89,591,278	N860S	probably damaging	Het
Chrm3	G	T	13: 9,877,997	D334E	probably benign	Het
Clic5	A	C	17: 44,275,259	T212P	probably benign	Het
Dapk1	G	A	13: 60,716,817		probably null	Het
Dync2h1	A	T	9: 7,049,114	L3262H	probably damaging	Het
Epg5	G	C	18: 77,983,476	W1227C	probably damaging	Het
Fancm	T	C	12: 65,124,856	S1757P	probably damaging	Het
Gm3604	G	C	13: 62,369,018	H509D	probably benign	Het
Gramd4	G	T	15: 86,122,183	E163*	probably null	Het
Hip1r	T	A	5: 124,000,593		probably null	Het
Ice1	G	T	13: 70,596,173	T2097K	probably damaging	Het
Il12a	TCAC	TC	3: 68,697,987		probably null	Het
Kbtbd7	A	G	14: 79,428,482	T585A	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnq3	T	C	15: 66,025,236	T272A	possibly damaging	Het
Ly6l	T	G	15: 75,449,632		probably null	Het
Mrps11	C	A	7: 78,788,749	A83E	probably damaging	Het
Olfr366	C	T	2: 37,220,176	P229L	probably damaging	Het
Pax7	T	C	4: 139,828,696	I156V	possibly damaging	Het
Plbd1	A	T	6: 136,634,574	V235D	probably damaging	Het
Pml	T	C	9: 58,247,243	S76G	possibly damaging	Het
Ppp1r42	T	A	1: 10,003,412		probably benign	Het
Rsl24d1	T	C	9: 73,122,303	L61S	probably damaging	Het
Rtp2	T	C	16: 23,927,485	E132G	probably damaging	Het
Sgk1	A	G	10: 21,994,816	I23V	probably benign	Het
Sharpin	A	G	15: 76,350,611		probably benign	Het
Sipa1l1	T	A	12: 82,357,331	Y533N	probably benign	Het
Slc12a9	T	C	5: 137,332,201	I81V	probably benign	Het
Stxbp5l	G	A	16: 37,208,186	T505M	possibly damaging	Het
Tmem40	A	G	6: 115,736,381		probably null	Het
Tnfrsf18	A	T	4: 156,028,270	N138Y	probably damaging	Het
Vmn2r87	A	T	10: 130,478,996	N240K	probably damaging	Het
Vmn2r91	A	G	17: 18,136,399	E776G	probably damaging	Het
Vmn2r92	T	A	17: 18,185,115	N840K	possibly damaging	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTTCCTGAAGGATATTGAAGTGAAAG -3'
(R):5'- ATCCTCATATGAGAGAGCATTGTGAG -3'

Sequencing Primer
(F):5'- GACAAAAGGAGTTTAGATTGGAGAC -3'
(R):5'- GCATTGTGAGATTTATTGAACACTG -3'

Posted On

2015-01-23