Incidental Mutation 'R2910:Tfpi'
ID261171
Institutional Source Beutler Lab
Gene Symbol Tfpi
Ensembl Gene ENSMUSG00000027082
Gene Nametissue factor pathway inhibitor
Synonyms
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84432855-84476775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84444093 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 184 (V184G)
Ref Sequence ENSEMBL: ENSMUSP00000107340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028487] [ENSMUST00000090732] [ENSMUST00000111711] [ENSMUST00000111714] [ENSMUST00000111717] [ENSMUST00000111718] [ENSMUST00000111722] [ENSMUST00000150261]
Predicted Effect probably benign
Transcript: ENSMUST00000028487
AA Change: V190G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028487
Gene: ENSMUSG00000027082
AA Change: V190G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090732
AA Change: V190G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088235
Gene: ENSMUSG00000027082
AA Change: V190G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111711
AA Change: V184G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107340
Gene: ENSMUSG00000027082
AA Change: V184G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111714
AA Change: V190G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107343
Gene: ENSMUSG00000027082
AA Change: V190G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111717
AA Change: V190G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107346
Gene: ENSMUSG00000027082
AA Change: V190G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111718
AA Change: V190G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107347
Gene: ENSMUSG00000027082
AA Change: V190G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 223 276 2.25e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111722
AA Change: V184G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107351
Gene: ENSMUSG00000027082
AA Change: V184G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 48 101 4.4e-25 SMART
KU 119 172 7.97e-23 SMART
KU 217 270 2.25e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144775
Predicted Effect possibly damaging
Transcript: ENSMUST00000150261
AA Change: V183G

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122776
Gene: ENSMUSG00000027082
AA Change: V183G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KU 41 94 4.4e-25 SMART
KU 112 165 7.97e-23 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant embryos die showing hemorrhages of the yolk sac, central nervous system, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Tfpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tfpi APN 2 84444825 nonsense probably null
IGL01860:Tfpi APN 2 84444034 missense probably benign 0.00
IGL02434:Tfpi APN 2 84452548 splice site probably benign
IGL03087:Tfpi APN 2 84444045 missense possibly damaging 0.61
I1329:Tfpi UTSW 2 84444116 missense possibly damaging 0.77
R0883:Tfpi UTSW 2 84443320 splice site probably benign
R1069:Tfpi UTSW 2 84453792 splice site probably benign
R1577:Tfpi UTSW 2 84433103 missense probably damaging 0.97
R1854:Tfpi UTSW 2 84458107 missense probably benign 0.00
R1991:Tfpi UTSW 2 84458016 splice site probably benign
R3085:Tfpi UTSW 2 84442883 utr 3 prime probably benign
R4403:Tfpi UTSW 2 84444862 missense probably damaging 0.98
R4473:Tfpi UTSW 2 84458082 missense probably null 1.00
R4878:Tfpi UTSW 2 84452555 critical splice donor site probably null
R5810:Tfpi UTSW 2 84434424 intron probably benign
R5949:Tfpi UTSW 2 84444748 missense probably benign 0.37
R6899:Tfpi UTSW 2 84444809 missense probably damaging 1.00
R8024:Tfpi UTSW 2 84453922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCTACATGCTACATACACAGAAGC -3'
(R):5'- GGGGAACTCAATTGCAACAAC -3'

Sequencing Primer
(F):5'- AATGTCTATAATTTAACATGCCCCTC -3'
(R):5'- CTTTGCTGTTTTTGACACAACAG -3'
Posted On2015-01-23