Incidental Mutation 'R2910:Tac1'
ID261185
Institutional Source Beutler Lab
Gene Symbol Tac1
Ensembl Gene ENSMUSG00000061762
Gene Nametachykinin 1
SynonymsNkna, preprotachykinin A, PPT-A, PPTA, 4930528L02Rik, NK1, neurokinin A, neurokinin 1, substance P, SP, NK-1
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7554879-7565834 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 7559097 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090679] [ENSMUST00000184986] [ENSMUST00000185130] [ENSMUST00000185187]
Predicted Effect probably benign
Transcript: ENSMUST00000090679
SMART Domains Protein: ENSMUSP00000088175
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 97 107 1.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184481
Predicted Effect probably null
Transcript: ENSMUST00000184986
SMART Domains Protein: ENSMUSP00000138818
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 82 92 1.36e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185130
Predicted Effect probably null
Transcript: ENSMUST00000185187
SMART Domains Protein: ENSMUSP00000139347
Gene: ENSMUSG00000061762

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TK 58 68 1.88e0 SMART
TK 97 107 1.36e1 SMART
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of agonist-induced hyperalgesia and an impaired response to chemical irritation of the urinary tract. Mice homozygous for a different knock-out allele display hypoalgesia, and reduced anxiety- and depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Tac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Tac1 APN 6 7559119 unclassified probably null
IGL02830:Tac1 APN 6 7555650 missense probably benign 0.00
IGL02926:Tac1 APN 6 7562410 missense possibly damaging 0.95
R0189:Tac1 UTSW 6 7562424 missense probably damaging 1.00
R0265:Tac1 UTSW 6 7559165 splice site probably benign
R0612:Tac1 UTSW 6 7555653 missense probably damaging 1.00
R2911:Tac1 UTSW 6 7559097 critical splice acceptor site probably null
R4547:Tac1 UTSW 6 7557216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCTCACAATATGGGTTTC -3'
(R):5'- ATCAGTGCACTCGTGGCTAC -3'

Sequencing Primer
(F):5'- CTCACAATATGGGTTTCAGCATGG -3'
(R):5'- GGCTACAGACACTATGAACATTTGTC -3'
Posted On2015-01-23