Incidental Mutation 'R2910:Iqcm'
ID 261191
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene Name IQ motif containing M
Synonyms 1700007B14Rik
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R2910 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 75448694-75984503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75714776 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 226 (I226F)
Ref Sequence ENSEMBL: ENSMUSP00000148495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
AlphaFold Q149I8
Predicted Effect probably benign
Transcript: ENSMUST00000034033
AA Change: I226F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: I226F

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120430
Predicted Effect probably benign
Transcript: ENSMUST00000121983
AA Change: I226F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: I226F

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212704
AA Change: I226F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
R8703:Iqcm UTSW 8 75888643 missense probably damaging 1.00
R9175:Iqcm UTSW 8 75984239 missense possibly damaging 0.84
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCAAGAATTTGAGGGTAATGTAG -3'
(R):5'- TGAGCTCTCAACAACTTATACTCC -3'

Sequencing Primer
(F):5'- ACTAAGCGTTATATATCTGCATGC -3'
(R):5'- TCCCTGGTATTTCAGTACTAAAGTC -3'
Posted On 2015-01-23