Mutagenetix > Incidental Mutation

Incidental Mutation 'R2910:Atp8b3'

261198

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

040497-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R2910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80519912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 1322 (S1322F)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020383
AA Change: S1322F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: S1322F

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051773

SMART Domains

Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
low complexity region	56	76	N/A	INTRINSIC
low complexity region	98	116	N/A	INTRINSIC
low complexity region	126	151	N/A	INTRINSIC
low complexity region	190	227	N/A	INTRINSIC
CUT	310	395	1.24e-42	SMART
HOX	411	473	1.07e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	G	A	11: 58,608,426	Q189*	probably null	Het
Abcf3	A	G	16: 20,560,232	T645A	probably damaging	Het
Acap1	A	G	11: 69,887,076		probably benign	Het
Adgrv1	G	A	13: 81,557,119	A1524V	possibly damaging	Het
Agbl1	A	G	7: 76,419,838	N121D	probably benign	Het
Ahnak	A	G	19: 9,011,654	D3434G	probably damaging	Het
Ankrd11	A	T	8: 122,908,798	D32E	probably damaging	Het
Asxl1	T	C	2: 153,401,039	S1170P	probably benign	Het
Car15	G	A	16: 17,838,142		probably benign	Het
Cep104	T	A	4: 153,995,427		probably null	Het
Cnnm1	A	G	19: 43,469,647	I633V	possibly damaging	Het
Cog8	A	T	8: 107,054,221	V135E	probably benign	Het
Cts6	A	G	13: 61,196,401	V279A	probably damaging	Het
Ddx1	C	T	12: 13,231,440		probably null	Het
Dock2	A	G	11: 34,232,910		probably benign	Het
Ero1lb	T	A	13: 12,600,289	D336E	probably damaging	Het
F11	C	G	8: 45,241,449	*625S	probably null	Het
F5	A	G	1: 164,204,820	M1779V	probably benign	Het
Fam227a	A	T	15: 79,636,734	D296E	possibly damaging	Het
Fbxo38	T	C	18: 62,519,807	D523G	probably benign	Het
Ggt1	G	A	10: 75,580,596	V275M	probably benign	Het
Gm379	A	C	X: 108,664,765	F43V	possibly damaging	Het
Grhl3	T	C	4: 135,559,146	I75V	probably benign	Het
Iqcm	A	T	8: 75,714,776	I226F	probably benign	Het
Kcnq1	T	G	7: 143,425,962	L615R	probably damaging	Het
Lcp2	G	A	11: 34,068,970		probably null	Het
Mbtps1	A	G	8: 119,546,037	I123T	possibly damaging	Het
Muc5ac	C	T	7: 141,807,641	T1563I	probably damaging	Het
Odf2l	A	C	3: 145,124,323	I19L	probably benign	Het
Olfr193	C	T	16: 59,110,181	R143H	probably benign	Het
Olfr993	T	A	2: 85,414,351	H176L	probably damaging	Het
Pigr	A	G	1: 130,849,533	D692G	probably damaging	Het
Pkd1l3	A	G	8: 109,667,636		probably benign	Het
Plekhg4	TAGTCGATGCCCGAGTC	TAGTC	8: 105,376,452		probably benign	Het
Reep2	T	C	18: 34,845,690		probably null	Het
Rubcnl	C	T	14: 75,040,808	T344I	probably benign	Het
Sema6d	C	A	2: 124,665,037	P941T	probably damaging	Het
Shcbp1l	C	A	1: 153,428,626	L144I	probably damaging	Het
Slc7a1	T	C	5: 148,352,257	E60G	probably benign	Het
Snx2	C	T	18: 53,199,874	P207S	probably damaging	Het
Spata31	T	G	13: 64,920,436	S133A	probably benign	Het
Tac1	A	G	6: 7,559,097		probably null	Het
Tfpi	A	C	2: 84,444,093	V184G	possibly damaging	Het
Tmeff1	C	A	4: 48,614,961	N139K	possibly damaging	Het
Tnxb	A	G	17: 34,672,450	D589G	probably damaging	Het
Trpc1	C	A	9: 95,749,842	A16S	probably benign	Het
Vmn2r106	A	C	17: 20,278,684	L322V	probably damaging	Het
Vmn2r69	G	T	7: 85,406,710	A740D	probably damaging	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTGAAAGGGCACTGACACGC -3'
(R):5'- TTTCTTTGGAAAGGGGTCCC -3'

Sequencing Primer
(F):5'- GCACTGACACGCACTCCATG -3'
(R):5'- CTTTGGAAAGGGGTCCCAGGAAG -3'

Posted On

2015-01-23