Incidental Mutation 'R2910:Ero1lb'
ID261204
Institutional Source Beutler Lab
Gene Symbol Ero1lb
Ensembl Gene ENSMUSG00000057069
Gene NameERO1-like beta (S. cerevisiae)
Synonyms
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2910 (G1)
Quality Score113
Status Not validated
Chromosome13
Chromosomal Location12565874-12611396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12600289 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 336 (D336E)
Ref Sequence ENSEMBL: ENSMUSP00000152543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071973] [ENSMUST00000220811] [ENSMUST00000221560]
Predicted Effect probably damaging
Transcript: ENSMUST00000071973
AA Change: D336E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071864
Gene: ENSMUSG00000057069
AA Change: D336E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:ERO1 56 456 2.5e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220811
AA Change: D336E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221560
AA Change: D336E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221739
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased circulating glucose levels, decreased pancreas insulin levels, and disorganized islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Ero1lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Ero1lb APN 13 12601734 critical splice acceptor site probably null
IGL02738:Ero1lb APN 13 12604433 missense possibly damaging 0.94
IGL03033:Ero1lb APN 13 12581670 missense probably damaging 1.00
R0607:Ero1lb UTSW 13 12574866 missense probably damaging 1.00
R0801:Ero1lb UTSW 13 12581687 missense probably benign 0.10
R1665:Ero1lb UTSW 13 12579261 critical splice donor site probably null
R1851:Ero1lb UTSW 13 12604403 missense possibly damaging 0.61
R1928:Ero1lb UTSW 13 12601759 missense probably damaging 1.00
R3719:Ero1lb UTSW 13 12583612 critical splice donor site probably null
R4873:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R4875:Ero1lb UTSW 13 12604436 missense probably damaging 0.99
R5053:Ero1lb UTSW 13 12599906 missense probably damaging 1.00
R5338:Ero1lb UTSW 13 12574851 missense probably damaging 1.00
R5415:Ero1lb UTSW 13 12601767 missense probably benign 0.02
R5800:Ero1lb UTSW 13 12602301 splice site probably null
R5907:Ero1lb UTSW 13 12600318 missense probably damaging 0.98
R5909:Ero1lb UTSW 13 12579258 missense probably benign 0.18
R6029:Ero1lb UTSW 13 12574833 missense probably damaging 1.00
R7234:Ero1lb UTSW 13 12600314 missense possibly damaging 0.72
R7331:Ero1lb UTSW 13 12600126 missense probably damaging 1.00
R7577:Ero1lb UTSW 13 12602365 missense probably damaging 0.99
R7726:Ero1lb UTSW 13 12605833 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACATCAAGGAGTTTAGACGCC -3'
(R):5'- ACACAGCCTGTTTTCCAGTG -3'

Sequencing Primer
(F):5'- GAGTTTAGACGCCGCTTTGACC -3'
(R):5'- TGTTCAGCATCTGGAAGACC -3'
Posted On2015-01-23