Incidental Mutation 'R2910:Cts6'
ID261205
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Namecathepsin 6
Synonyms
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61195132-61203410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61196401 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 279 (V279A)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
Predicted Effect probably damaging
Transcript: ENSMUST00000021890
AA Change: V279A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: V279A

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Meta Mutation Damage Score 0.3829 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61198339 splice site probably benign
IGL00774:Cts6 APN 13 61198339 splice site probably benign
IGL02237:Cts6 APN 13 61197499 missense probably benign 0.01
IGL03071:Cts6 APN 13 61202250 missense probably damaging 0.97
IGL03224:Cts6 APN 13 61201733 missense probably damaging 1.00
IGL03282:Cts6 APN 13 61196447 missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61196457 splice site probably benign
R0201:Cts6 UTSW 13 61201499 nonsense probably null
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0401:Cts6 UTSW 13 61198339 splice site probably benign
R0676:Cts6 UTSW 13 61197484 splice site probably benign
R1471:Cts6 UTSW 13 61196380 missense probably benign 0.00
R1594:Cts6 UTSW 13 61198367 missense probably damaging 1.00
R1864:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1865:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1902:Cts6 UTSW 13 61201515 nonsense probably null
R2097:Cts6 UTSW 13 61195445 missense probably damaging 1.00
R2235:Cts6 UTSW 13 61195433 missense probably damaging 1.00
R2829:Cts6 UTSW 13 61201497 missense probably benign 0.01
R3757:Cts6 UTSW 13 61202158 nonsense probably null
R4460:Cts6 UTSW 13 61195458 missense probably benign 0.25
R4553:Cts6 UTSW 13 61197593 missense probably damaging 1.00
R4623:Cts6 UTSW 13 61202160 missense possibly damaging 0.57
R4793:Cts6 UTSW 13 61201812 missense probably benign 0.00
R4809:Cts6 UTSW 13 61202181 missense probably damaging 1.00
R4849:Cts6 UTSW 13 61201601 missense probably null
R4866:Cts6 UTSW 13 61202276 critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61196350 missense probably damaging 1.00
R5590:Cts6 UTSW 13 61201812 missense probably benign 0.00
R6236:Cts6 UTSW 13 61196378 nonsense probably null
R6428:Cts6 UTSW 13 61196423 missense probably damaging 0.96
R6501:Cts6 UTSW 13 61196335 missense probably damaging 1.00
R6508:Cts6 UTSW 13 61196407 missense probably damaging 1.00
R6643:Cts6 UTSW 13 61201793 missense probably damaging 0.96
R7397:Cts6 UTSW 13 61202200 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATTACTGACTGCAACGGGC -3'
(R):5'- AGGTTCTAAGGACTCATCTCATGTC -3'

Sequencing Primer
(F):5'- GCAACGGGCAATTTTGTCATG -3'
(R):5'- GTTTTGTGAGGCTTTATACATGTTAG -3'
Posted On2015-01-23