Incidental Mutation 'R2910:Rubcnl'
ID261208
Institutional Source Beutler Lab
Gene Symbol Rubcnl
Ensembl Gene ENSMUSG00000034959
Gene NameRUN and cysteine rich domain containing beclin 1 interacting protein like
SynonymsLOC380917, 5031414D18Rik
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75016027-75052532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75040808 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 344 (T344I)
Ref Sequence ENSEMBL: ENSMUSP00000045566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036072]
Predicted Effect probably benign
Transcript: ENSMUST00000036072
AA Change: T344I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045566
Gene: ENSMUSG00000034959
AA Change: T344I

DomainStartEndE-ValueType
DUF4206 463 664 1.01e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228689
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Rubcnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02571:Rubcnl APN 14 75032136 missense possibly damaging 0.75
IGL02730:Rubcnl APN 14 75050148 missense probably damaging 1.00
R0019:Rubcnl UTSW 14 75048263 splice site probably benign
R0147:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0148:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0350:Rubcnl UTSW 14 75040891 missense probably damaging 0.99
R0487:Rubcnl UTSW 14 75036081 missense probably benign 0.18
R0558:Rubcnl UTSW 14 75047547 missense probably damaging 1.00
R1537:Rubcnl UTSW 14 75040827 missense possibly damaging 0.92
R1791:Rubcnl UTSW 14 75047549 missense probably damaging 1.00
R1871:Rubcnl UTSW 14 75042409 missense possibly damaging 0.58
R2227:Rubcnl UTSW 14 75042392 missense probably benign 0.00
R2263:Rubcnl UTSW 14 75040820 missense possibly damaging 0.93
R2911:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R3826:Rubcnl UTSW 14 75032225 missense possibly damaging 0.72
R3870:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R3871:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R4007:Rubcnl UTSW 14 75049703 missense possibly damaging 0.93
R4161:Rubcnl UTSW 14 75044458 missense possibly damaging 0.82
R5004:Rubcnl UTSW 14 75032177 nonsense probably null
R5041:Rubcnl UTSW 14 75050132 missense probably damaging 1.00
R5468:Rubcnl UTSW 14 75032031 missense possibly damaging 0.49
R5495:Rubcnl UTSW 14 75042337 missense possibly damaging 0.61
R5739:Rubcnl UTSW 14 75040941 splice site probably null
R5910:Rubcnl UTSW 14 75035472 missense probably benign 0.26
R5948:Rubcnl UTSW 14 75047616 missense probably damaging 1.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6197:Rubcnl UTSW 14 75031929 missense probably damaging 0.99
R6297:Rubcnl UTSW 14 75050144 missense probably benign 0.06
R6372:Rubcnl UTSW 14 75047569 missense probably damaging 0.99
R6376:Rubcnl UTSW 14 75032394 missense probably benign 0.01
R6377:Rubcnl UTSW 14 75050195 splice site probably null
R6724:Rubcnl UTSW 14 75052010 missense probably benign 0.00
R6884:Rubcnl UTSW 14 75035470 missense probably benign 0.23
R7183:Rubcnl UTSW 14 75049626 missense probably damaging 0.97
R7186:Rubcnl UTSW 14 75032013 missense possibly damaging 0.91
R7345:Rubcnl UTSW 14 75042353 missense probably benign
R7423:Rubcnl UTSW 14 75049643 missense probably benign 0.09
R7548:Rubcnl UTSW 14 75042352 missense probably benign
R7606:Rubcnl UTSW 14 75038874 missense probably benign 0.41
R7781:Rubcnl UTSW 14 75032090 missense probably damaging 1.00
RF011:Rubcnl UTSW 14 75044438 missense probably damaging 0.99
Z1176:Rubcnl UTSW 14 75036197 missense not run
Predicted Primers PCR Primer
(F):5'- GAAGGATTTGAACTCTGCTTTTCTG -3'
(R):5'- TCCATTTTGAGACTTCCTAAACACC -3'

Sequencing Primer
(F):5'- GCTTTTCTGACTTTAAATGCAGTAC -3'
(R):5'- GCCAGTGAGAAATCAAGAACATTTC -3'
Posted On2015-01-23