Incidental Mutation 'R2910:Olfr193'
ID261212
Institutional Source Beutler Lab
Gene Symbol Olfr193
Ensembl Gene ENSMUSG00000060057
Gene Nameolfactory receptor 193
SynonymsOlfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59107924-59111881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59110181 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 143 (R143H)
Ref Sequence ENSEMBL: ENSMUSP00000146393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]
Predicted Effect probably benign
Transcript: ENSMUST00000076262
AA Change: R143H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: R143H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-48 PFAM
Pfam:7tm_1 41 290 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207935
Predicted Effect probably benign
Transcript: ENSMUST00000208455
AA Change: R143H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Olfr193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr193 APN 16 59110598 missense probably benign
IGL01613:Olfr193 APN 16 59109921 missense probably damaging 1.00
IGL02280:Olfr193 APN 16 59110332 missense probably damaging 1.00
IGL02533:Olfr193 APN 16 59109684 missense probably benign
IGL02544:Olfr193 APN 16 59110144 missense probably damaging 1.00
IGL02576:Olfr193 APN 16 59109771 missense probably benign
IGL02719:Olfr193 APN 16 59110173 missense probably benign 0.01
IGL03215:Olfr193 APN 16 59109962 missense possibly damaging 0.46
IGL03272:Olfr193 APN 16 59110556 missense probably benign 0.01
PIT4802001:Olfr193 UTSW 16 59110601 missense probably benign
R0544:Olfr193 UTSW 16 59110225 missense probably benign 0.03
R0783:Olfr193 UTSW 16 59110169 nonsense probably null
R1070:Olfr193 UTSW 16 59109819 missense probably benign 0.08
R1211:Olfr193 UTSW 16 59110160 missense possibly damaging 0.68
R1662:Olfr193 UTSW 16 59110604 missense probably benign 0.00
R1754:Olfr193 UTSW 16 59110581 missense probably benign 0.03
R1765:Olfr193 UTSW 16 59109755 missense probably damaging 1.00
R1937:Olfr193 UTSW 16 59109794 missense probably benign 0.11
R2875:Olfr193 UTSW 16 59109802 missense probably benign 0.01
R2911:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R5084:Olfr193 UTSW 16 59110073 missense possibly damaging 0.90
R5700:Olfr193 UTSW 16 59109993 missense probably damaging 0.99
R7018:Olfr193 UTSW 16 59110607 start codon destroyed probably null 0.98
R7083:Olfr193 UTSW 16 59110037 missense probably damaging 1.00
R7572:Olfr193 UTSW 16 59110430 missense probably damaging 1.00
R7720:Olfr193 UTSW 16 59109771 missense probably benign
R8045:Olfr193 UTSW 16 59110039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGAATACCTGAATTGAGCCAGAG -3'
(R):5'- GTGACACCAAAGATGCTACAAG -3'

Sequencing Primer
(F):5'- TTGAGCCAGAGAAAATAAAGAGCATC -3'
(R):5'- GATGCTACAAGACATTTTTGCCAAG -3'
Posted On2015-01-23