Incidental Mutation 'R2910:Snx2'
ID261216
Institutional Source Beutler Lab
Gene Symbol Snx2
Ensembl Gene ENSMUSG00000034484
Gene Namesorting nexin 2
Synonyms0610030A03Rik
MMRRC Submission 040497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location53176365-53220860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53199874 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 207 (P207S)
Ref Sequence ENSEMBL: ENSMUSP00000039243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037850]
Predicted Effect probably damaging
Transcript: ENSMUST00000037850
AA Change: P207S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484
AA Change: P207S

DomainStartEndE-ValueType
Pfam:Sorting_nexin 2 134 1.6e-29 PFAM
PX 138 265 1.4e-38 SMART
Pfam:Vps5 281 514 2.2e-90 PFAM
Meta Mutation Damage Score 0.6677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Snx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Snx2 APN 18 53216400 missense possibly damaging 0.95
IGL00861:Snx2 APN 18 53210797 splice site probably null
IGL01116:Snx2 APN 18 53194423 splice site probably benign
IGL01642:Snx2 APN 18 53216447 missense probably damaging 0.99
IGL02178:Snx2 APN 18 53199785 missense possibly damaging 0.61
IGL02368:Snx2 APN 18 53189721 missense probably benign
IGL02597:Snx2 APN 18 53210372 missense probably benign 0.09
IGL02964:Snx2 APN 18 53194558 missense probably benign 0.00
IGL03372:Snx2 APN 18 53216391 missense probably damaging 1.00
blanched UTSW 18 53194444 missense probably damaging 0.98
bleached UTSW 18 53197925 splice site probably null
R0332:Snx2 UTSW 18 53212911 missense probably benign 0.01
R0723:Snx2 UTSW 18 53210372 missense probably benign 0.09
R0746:Snx2 UTSW 18 53197889 missense possibly damaging 0.90
R0826:Snx2 UTSW 18 53194522 missense probably benign 0.00
R0894:Snx2 UTSW 18 53176416 missense probably benign
R0970:Snx2 UTSW 18 53210690 splice site probably benign
R1897:Snx2 UTSW 18 53197878 missense probably damaging 0.99
R2049:Snx2 UTSW 18 53194444 missense probably damaging 0.98
R2911:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R4460:Snx2 UTSW 18 53176444 missense probably benign 0.31
R5225:Snx2 UTSW 18 53189712 missense possibly damaging 0.91
R5352:Snx2 UTSW 18 53197925 splice site probably null
R5450:Snx2 UTSW 18 53210712 missense probably damaging 0.99
R5576:Snx2 UTSW 18 53210750 missense probably benign 0.33
R5965:Snx2 UTSW 18 53194462 nonsense probably null
R6063:Snx2 UTSW 18 53209625 nonsense probably null
R6222:Snx2 UTSW 18 53199824 nonsense probably null
R6291:Snx2 UTSW 18 53209665 critical splice donor site probably null
R6890:Snx2 UTSW 18 53212879 missense probably damaging 1.00
R7380:Snx2 UTSW 18 53194568 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGATTCATTTGCAAAACAGAGG -3'
(R):5'- TTTAAGGATGTGTGGGACCAAC -3'

Sequencing Primer
(F):5'- CCACTTACAGTCATGTGCAGTAG -3'
(R):5'- TGTGGGACCAACACAGCAC -3'
Posted On2015-01-23