Incidental Mutation 'R2911:Sox17'
ID261221
Institutional Source Beutler Lab
Gene Symbol Sox17
Ensembl Gene ENSMUSG00000025902
Gene NameSRY (sex determining region Y)-box 17
Synonyms
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location4490931-4497354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4493131 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 92 (D92E)
Ref Sequence ENSEMBL: ENSMUSP00000141674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027035
AA Change: D92E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: D92E

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 417 9.5e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116652
AA Change: D92E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: D92E

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 330 9.8e-19 PFAM
Pfam:Sox_C_TAD 312 418 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191647
SMART Domains Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 3.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191939
AA Change: D92E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902
AA Change: D92E

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192505
Predicted Effect probably benign
Transcript: ENSMUST00000192650
SMART Domains Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 2.5e-7 PFAM
low complexity region 117 128 N/A INTRINSIC
Pfam:Sox_C_TAD 132 266 6.1e-16 PFAM
Pfam:Sox_C_TAD 255 353 4.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192913
AA Change: D92E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902
AA Change: D92E

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194935
Predicted Effect probably benign
Transcript: ENSMUST00000195555
SMART Domains Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
SCOP:d2lefa_ 1 21 6e-4 SMART
low complexity region 54 65 N/A INTRINSIC
Pfam:Sox_C_TAD 69 202 4.6e-16 PFAM
Pfam:Sox_C_TAD 192 290 3.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Sox17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sox17 APN 1 4492203 missense possibly damaging 0.66
rheas UTSW 1 4492432 missense possibly damaging 0.71
R1160:Sox17 UTSW 1 4491852 missense probably damaging 1.00
R1503:Sox17 UTSW 1 4491928 missense probably damaging 1.00
R3004:Sox17 UTSW 1 4492617 missense probably damaging 1.00
R3508:Sox17 UTSW 1 4492155 missense probably damaging 0.98
R4596:Sox17 UTSW 1 4492637 missense possibly damaging 0.91
R5274:Sox17 UTSW 1 4491888 missense possibly damaging 0.74
R6544:Sox17 UTSW 1 4492432 missense possibly damaging 0.71
R7496:Sox17 UTSW 1 4492327 missense probably damaging 0.96
R7704:Sox17 UTSW 1 4493672 intron probably benign
Z1088:Sox17 UTSW 1 4492302 missense probably damaging 1.00
Z1177:Sox17 UTSW 1 4492473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCGCTCCTATGGCCCAAAG -3'
(R):5'- ATCTCCAGGCTAGCTTCCGATC -3'

Sequencing Primer
(F):5'- TATGGCCCAAAGACCAAAGTGTTAC -3'
(R):5'- GATACGCCAGTGACGACCAG -3'
Posted On2015-01-23